ID: 967363130

View in Genome Browser
Species Human (GRCh38)
Location 3:188654919-188654941
Sequence ATTGTAGTCCAGGAGTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967363125_967363130 22 Left 967363125 3:188654874-188654896 CCAGCAGGAAGGAAACAATCCTA 0: 1
1: 0
2: 0
3: 15
4: 216
Right 967363130 3:188654919-188654941 ATTGTAGTCCAGGAGTTTGATGG 0: 1
1: 0
2: 1
3: 18
4: 231
967363126_967363130 3 Left 967363126 3:188654893-188654915 CCTAATCATACTAATACCAATGG 0: 1
1: 0
2: 0
3: 11
4: 130
Right 967363130 3:188654919-188654941 ATTGTAGTCCAGGAGTTTGATGG 0: 1
1: 0
2: 1
3: 18
4: 231
967363124_967363130 23 Left 967363124 3:188654873-188654895 CCCAGCAGGAAGGAAACAATCCT 0: 1
1: 0
2: 0
3: 28
4: 225
Right 967363130 3:188654919-188654941 ATTGTAGTCCAGGAGTTTGATGG 0: 1
1: 0
2: 1
3: 18
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967363130 Original CRISPR ATTGTAGTCCAGGAGTTTGA TGG Intronic
901558351 1:10049525-10049547 ACTTGAGCCCAGGAGTTTGAGGG + Intronic
902302961 1:15515836-15515858 ACTGGAGCACAGGAGTTTGAGGG + Intronic
903608221 1:24590688-24590710 ACTTGAGCCCAGGAGTTTGATGG - Intronic
903999865 1:27332798-27332820 AGTGTAGTCCAGGAGTCTCTGGG + Intronic
904689226 1:32281375-32281397 ATTTGAGCCCAGGAGGTTGAGGG + Intronic
905191500 1:36238788-36238810 TTTCAAGCCCAGGAGTTTGAGGG - Intronic
906294709 1:44642487-44642509 ATTGTAGACCAGGAGGGAGAAGG + Intronic
906304439 1:44707637-44707659 ACTTGAGCCCAGGAGTTTGAGGG - Intronic
906765441 1:48427006-48427028 ACTTGAGCCCAGGAGTTTGAGGG - Intronic
907376528 1:54047883-54047905 GTTTGAGCCCAGGAGTTTGAGGG + Intronic
909768390 1:79387471-79387493 AATGAAGTGCAGGAGTTTGAGGG + Intergenic
911868707 1:103063595-103063617 ATTGTCTTCTAGGAGTTTCATGG - Intronic
915365358 1:155312247-155312269 ATTGTACTCCAGGACCTGGAGGG - Exonic
915908424 1:159896807-159896829 CTTGTGCTCCAGGAGTTGGATGG - Intronic
916550310 1:165843693-165843715 TGTGGAGGCCAGGAGTTTGAGGG + Intronic
918043146 1:180925522-180925544 ATTTTAATCCAGGATTATGATGG + Intronic
918930723 1:190853239-190853261 ATTGTCTTCCAGGATTTTTATGG + Intergenic
919338423 1:196269444-196269466 ATTATAGTCCAGAAGTTTAGAGG + Intronic
920389418 1:205589832-205589854 ATTGTAGTCCAGGCGCAAGAGGG + Intronic
922768701 1:228170413-228170435 ACTTGAGCCCAGGAGTTTGAAGG - Intronic
922931813 1:229395995-229396017 ACTTGAGACCAGGAGTTTGAGGG + Intergenic
923337548 1:232983554-232983576 ACTGTAGTCCAGGCGATTGGTGG - Exonic
923423394 1:233843463-233843485 ACTTGAGCCCAGGAGTTTGAGGG - Intergenic
924365587 1:243289881-243289903 CTTGTAGCCCTGGACTTTGATGG + Intronic
1063563410 10:7150196-7150218 ACTTGAGTCCAGGAGTTGGAAGG - Intergenic
1064192596 10:13220684-13220706 GTTTGAGGCCAGGAGTTTGAGGG - Intergenic
1065044746 10:21737143-21737165 ACTGGAGCCCAGGAGGTTGAGGG + Intronic
1065605930 10:27417850-27417872 ACTTTAGGTCAGGAGTTTGAGGG + Intergenic
1066063574 10:31745512-31745534 TCTTGAGTCCAGGAGTTTGAGGG + Intergenic
1068847716 10:61698347-61698369 ATTGCAGTCCATGTGTTTAATGG + Intronic
1068976093 10:63011319-63011341 ACTTGAGCCCAGGAGTTTGAGGG - Intergenic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1073729273 10:106270573-106270595 ATGATAGACCAGGAATTTGATGG + Intergenic
1074227977 10:111505992-111506014 ATTATAGACCAGGAGTATTATGG - Intergenic
1074614985 10:115058796-115058818 ACTTTAGTCCAGGAGTTTCAAGG + Intergenic
1074991298 10:118710679-118710701 ATTGCCCTCCAGGGGTTTGAAGG - Intronic
1075603024 10:123784596-123784618 AGGGTAGTCCAGGTGATTGAAGG - Intronic
1078013854 11:7595265-7595287 ATTGTAGCACAGATGTTTGAGGG + Intronic
1078137145 11:8661040-8661062 AGTGTAGTCCCGGAGTCAGAGGG + Intronic
1078392224 11:10945149-10945171 ATTTTAATACAGGATTTTGATGG - Intergenic
1082663493 11:55945220-55945242 GTTTGAGTTCAGGAGTTTGAGGG - Intergenic
1085096481 11:73764685-73764707 ATTGAAGCCCAGGAGTATGTAGG + Intergenic
1085362836 11:75907594-75907616 ACTTGAGCCCAGGAGTTTGAGGG - Intronic
1085694299 11:78690798-78690820 ATTTCAGTCCAGCAGTTTAATGG + Intronic
1086253917 11:84851456-84851478 ATTGGAGCCCAGGAGTTTTGTGG + Intronic
1086558464 11:88140022-88140044 ATTCTGGTCCTGGAGTGTGAAGG + Intronic
1087169824 11:95038945-95038967 ACTTGAGCCCAGGAGTTTGAGGG - Intergenic
1089773894 11:120822722-120822744 TTTGTGGACCAGGAGTTTTATGG + Intronic
1090319295 11:125828304-125828326 ATTGGAGGCCAGAAGTCTGATGG - Intergenic
1091088061 11:132742859-132742881 ATTGTACTTCAGTATTTTGAAGG - Intronic
1091917324 12:4279006-4279028 ATTTTAGTTCAGGAGTTTGGAGG + Intronic
1092483956 12:8885326-8885348 ACTTGAGGCCAGGAGTTTGAAGG + Intronic
1093953665 12:25192928-25192950 ACTTGAGCCCAGGAGTTTGAGGG + Intronic
1095696396 12:45149007-45149029 GTTTGAGCCCAGGAGTTTGAGGG + Intergenic
1095869122 12:47006380-47006402 ACTTGAGTCCAGGAGTTTGATGG + Intergenic
1095886449 12:47193494-47193516 ATTGTAATCCAGGCGAGTGAAGG - Intronic
1096399621 12:51295013-51295035 ACTTGAGTGCAGGAGTTTGAGGG - Intronic
1097218601 12:57433376-57433398 ATTTGAGCCCAGGAGGTTGAAGG - Intergenic
1097549734 12:61052365-61052387 ATTGATTTCAAGGAGTTTGAGGG - Intergenic
1098142740 12:67468075-67468097 ACTTGAGCCCAGGAGTTTGAAGG - Intergenic
1099427673 12:82544706-82544728 ACTTGAGTCCAGGAGGTTGAGGG - Intergenic
1101720237 12:107344590-107344612 ATTGTAGTTCAGTGATTTGAGGG - Intronic
1102142620 12:110628055-110628077 ATTTTACTCCAGGACTTTCACGG + Intronic
1102460891 12:113098927-113098949 ACTGAAGTCCAGAAGTTTGAGGG + Exonic
1102477731 12:113199799-113199821 ACTTTAGCCCAGGAGTTTGGAGG - Intronic
1103239453 12:119400690-119400712 AATGTAGTCCATGAATTTGCAGG + Intronic
1106278207 13:28235803-28235825 ACAGGAGCCCAGGAGTTTGAGGG - Intronic
1108433292 13:50376389-50376411 AATGTAGTTCATGAGTTTGTTGG - Intronic
1109401571 13:61836868-61836890 ATTGTAGTCCAAAAATATGACGG - Intergenic
1110598331 13:77342754-77342776 ACTTGAGCCCAGGAGTTTGAGGG - Intergenic
1115374600 14:32660525-32660547 ATTCTAGTTCAGGAATTTGAGGG + Intronic
1116179255 14:41515507-41515529 ATTGTATTCCAGAAGGTTAAAGG - Intergenic
1118598876 14:67457520-67457542 ATTTGAGCCCAGGAGTTTGGAGG + Intronic
1122240717 14:100365036-100365058 GTGGGAGCCCAGGAGTTTGAGGG + Intronic
1125278074 15:38014560-38014582 ATTGTCTTCCAAGAGTTAGAGGG + Intergenic
1125934206 15:43620527-43620549 GCTTGAGTCCAGGAGTTTGAGGG - Intergenic
1125947311 15:43719993-43720015 GCTTGAGTCCAGGAGTTTGAGGG - Intergenic
1126871912 15:52998519-52998541 ATTGTCTTCCAGGACTTTTATGG - Intergenic
1127444703 15:59049016-59049038 ACTGGAGCCCAGGAGATTGACGG + Intronic
1131041462 15:89271579-89271601 ACTTGAGGCCAGGAGTTTGAGGG - Intronic
1131909288 15:97178955-97178977 TTTGCAGTCCAGAATTTTGAAGG - Intergenic
1132078436 15:98843156-98843178 ATTGTAGCACAGCAGGTTGAAGG - Intronic
1133579506 16:7129519-7129541 ATTGTAATCCAAGAGTATCATGG - Intronic
1134753833 16:16648761-16648783 ACTTGAGTCCAGGAGTTAGAGGG - Intergenic
1134992226 16:18710283-18710305 ACTTGAGTCCAGGAGTTAGAGGG + Intergenic
1136519929 16:30788686-30788708 ACTTGAGCCCAGGAGTTTGAAGG + Intergenic
1136668324 16:31834172-31834194 ACTTGAGTCCAGGAGGTTGAAGG + Intergenic
1137434233 16:48442591-48442613 ACTTGAGCCCAGGAGTTTGAGGG - Intronic
1138097953 16:54228284-54228306 ATGCCAGTCCAGGAGTCTGAAGG + Intergenic
1138728375 16:59166010-59166032 AGTTGAGGCCAGGAGTTTGAGGG + Intergenic
1141206402 16:81936238-81936260 ATTGTACTTCAGGAGGTCGACGG - Exonic
1145099043 17:20058410-20058432 ACTTGAGTCCAGGAGTTTGAGGG + Intronic
1146207102 17:30914356-30914378 CAGGTAGTCCAGGAGTTTGTAGG - Intronic
1147617698 17:41839565-41839587 ATTGTAACCCAGGAGGTAGAAGG + Intronic
1148149833 17:45390042-45390064 ATTATTTTCCAGGAGTTTGCTGG - Intergenic
1149039021 17:52165441-52165463 ATTTTAGTCCATGCGTTTGCAGG - Intergenic
1150341663 17:64373339-64373361 ACTCAAGCCCAGGAGTTTGAGGG + Intronic
1151655207 17:75492619-75492641 ATTGAGGCCCAGGGGTTTGAGGG - Exonic
1152457875 17:80426429-80426451 ACTTGAGCCCAGGAGTTTGAGGG + Intronic
1152489927 17:80623989-80624011 ACTTGAGCCCAGGAGTTTGAGGG - Intronic
1153261255 18:3226490-3226512 GCTGGAGTCCTGGAGTTTGAGGG - Intergenic
1156792575 18:40993806-40993828 ACTGGAGCCCAGGAGTTTGAGGG - Intergenic
1158505145 18:58040955-58040977 ACTTGAGTCCTGGAGTTTGAGGG + Intergenic
1158799732 18:60892235-60892257 AGGGAAGTCCAGGAGTCTGAAGG + Intergenic
1161987476 19:7664384-7664406 GTTTGAGCCCAGGAGTTTGAGGG - Intergenic
1163047403 19:14654344-14654366 GCTTGAGTCCAGGAGTTTGAGGG - Intronic
1163349899 19:16769918-16769940 ACTGGAGCCCAGGAGTTTGAAGG - Intronic
1165910320 19:39222037-39222059 ACTGAAGCCCAGGAGTTTGGAGG - Intergenic
1166614102 19:44227632-44227654 ACTTCAGCCCAGGAGTTTGACGG - Intronic
1167056782 19:47116100-47116122 ACTGGAGCCCAGGAGGTTGAAGG + Intronic
1167955308 19:53059223-53059245 ATTGTATTCCAGGAGCCTGGGGG - Intergenic
926789305 2:16554281-16554303 ATTGCAGTCCAGAAGGTTTATGG - Intronic
927671751 2:25074221-25074243 ATTCTGGTTCAGGAGTCTGATGG - Intronic
927965990 2:27268757-27268779 ATAGTAGACAATGAGTTTGAAGG + Intronic
930204061 2:48571178-48571200 ATTGTCCTCTAGGAGTTTGCAGG + Intronic
930499066 2:52188309-52188331 ACTTGAGGCCAGGAGTTTGAGGG + Intergenic
930778228 2:55196551-55196573 AATGTTGTCCCGGAGTTTGGGGG - Intronic
931328607 2:61255049-61255071 ACTTGAGCCCAGGAGTTTGAGGG - Intronic
931974954 2:67633330-67633352 AGTGGAGACCAGGAGTCTGATGG + Intergenic
933333760 2:80927983-80928005 ATTTTAGTCCAGGAATTTTGTGG - Intergenic
934525772 2:95050712-95050734 ATTGTAGGCTGGGAGCTTGAGGG - Intronic
936652335 2:114442355-114442377 ATTGCAGTCCTGCAGTTTAAAGG - Intronic
937038781 2:118804818-118804840 ATTGAAGTTCACGAGTTTTATGG + Intergenic
937190099 2:120087060-120087082 TTTTTAGTTCAGGAGTTAGATGG + Intronic
937609534 2:123843422-123843444 ATTGTGGTCCAAGAGTATGGTGG - Intergenic
940986114 2:160053737-160053759 ATTGTAGGGCAGGAGTTGGGAGG + Intronic
941017790 2:160376716-160376738 ACTTGAGCCCAGGAGTTTGAGGG - Intronic
942304712 2:174595206-174595228 GCTTGAGTCCAGGAGTTTGAGGG + Intronic
943284062 2:185974475-185974497 ATTGTAATCCTGAAGTTTGAAGG - Intergenic
943846234 2:192652590-192652612 ACTTGAGTCCAGGAGGTTGAGGG + Intergenic
944782024 2:203028926-203028948 ATTGTGGTCCAGGATATAGATGG - Intronic
1169088584 20:2842217-2842239 ACTGGAGCCCAGAAGTTTGAGGG + Intronic
1169321886 20:4639881-4639903 GTTTGAGTCTAGGAGTTTGAGGG + Intergenic
1169614165 20:7420650-7420672 ACTTGAGCCCAGGAGTTTGAGGG - Intergenic
1170019601 20:11821636-11821658 ACTTGAGCCCAGGAGTTTGAAGG + Intergenic
1170925663 20:20721030-20721052 ACTTGAGTCCAGGACTTTGAGGG + Intergenic
1175087568 20:56472920-56472942 ATTTGAGTCCAGGAGTTTGGGGG + Intronic
1175352836 20:58337663-58337685 GTAGAAGTCCAGGTGTTTGAAGG + Intronic
1175609867 20:60341787-60341809 ATTTGAGTCCAGGAGGTTGAGGG + Intergenic
1175723095 20:61299359-61299381 TCTGGAGCCCAGGAGTTTGACGG - Intronic
1177073998 21:16549309-16549331 GTTTGCGTCCAGGAGTTTGAGGG + Intergenic
1178927270 21:36786490-36786512 ATTAAAGCCCAGGATTTTGATGG - Intronic
1179806355 21:43840324-43840346 AGTTGAGCCCAGGAGTTTGAGGG - Intergenic
1181950959 22:26553453-26553475 ATTTGAGACCAGGAGTTTCAAGG - Intronic
1184214359 22:43056873-43056895 GCTTGAGTCCAGGAGTTTGAGGG - Intronic
1184377130 22:44120756-44120778 ACTGGAGCCCAGGAGTTTGAGGG - Intronic
949293812 3:2496892-2496914 ATAGAAGTCCTGGAGTCTGAAGG + Intronic
949625765 3:5865346-5865368 ATTGATTTCCTGGAGTTTGAAGG - Intergenic
952009654 3:28885974-28885996 CCTGTAGTCCAGGAGGCTGAGGG + Intergenic
952788585 3:37179544-37179566 CTTGTAATCCAGCACTTTGAGGG + Intronic
954187645 3:48931167-48931189 CTTGGAACCCAGGAGTTTGAGGG - Intronic
957081930 3:75643655-75643677 ACTGAAGTCCAGGAGGTTGTGGG - Intergenic
961113688 3:124309476-124309498 ATTTGACTCCAGGAGTTTTATGG + Intronic
962107026 3:132401109-132401131 ACTTGAGTCCAGGAGTTCGAGGG + Intergenic
962744863 3:138389697-138389719 ATTGAGGTCCAGGAGTTAAAGGG - Intronic
962842354 3:139246934-139246956 ATTTTCGTTCTGGAGTTTGAAGG + Intronic
963537762 3:146549334-146549356 ATTTTCTTCCAGGAGTTTAACGG - Intergenic
964965752 3:162491055-162491077 ACTGGAGCCCAGGAGTTCGAGGG - Intergenic
965408347 3:168298870-168298892 ACTTGAGGCCAGGAGTTTGAGGG - Intergenic
965914828 3:173830904-173830926 ATTGAAGTTCAGGATTTTCAAGG + Intronic
966166667 3:177027076-177027098 ACTCTAGCCCAGGAGTTAGAAGG - Intronic
967363130 3:188654919-188654941 ATTGTAGTCCAGGAGTTTGATGG + Intronic
967882284 3:194310267-194310289 TTTGCAGAGCAGGAGTTTGAGGG - Intergenic
970388299 4:15579244-15579266 ACTTGAGCCCAGGAGTTTGAGGG + Intronic
971402424 4:26288262-26288284 ATTGTAGTCAAGAAGTTGGCTGG + Intronic
972424702 4:38921477-38921499 ACTTGAGCCCAGGAGTTTGAGGG - Intronic
973159352 4:46995579-46995601 ACTTGAGACCAGGAGTTTGAGGG - Intronic
973268037 4:48230905-48230927 ATTATGGCCCAGGAGTTGGAAGG - Intronic
975746840 4:77483231-77483253 ATTGTGCTCCAGGAGTTACAAGG - Intergenic
977158111 4:93599577-93599599 ATTGTTTTCCAGTAGATTGATGG - Intronic
978075412 4:104522918-104522940 ATTGTAGTCCAGCAGTACCAGGG + Intergenic
978677439 4:111336836-111336858 ATAGAAGTCTAGGATTTTGAAGG + Intergenic
979347621 4:119607091-119607113 ATTGTTGTCAAGGATTCTGAGGG - Exonic
979666411 4:123315858-123315880 CTTGAGCTCCAGGAGTTTGAAGG - Exonic
982338579 4:154268993-154269015 CTTGCAGTCCAGGTGTCTGAGGG - Intronic
982696376 4:158606664-158606686 ACTTAAGTCCAGGAGTTTGAGGG - Intronic
983361134 4:166724824-166724846 ATTTTAGCCCTGGATTTTGATGG - Intergenic
984633842 4:182089982-182090004 GTTGTAGTCCAGGAATTAGATGG - Intergenic
986588917 5:9348410-9348432 ATCACAGTCCAGGAATTTGAGGG - Intronic
987637134 5:20558348-20558370 AGTGTTATCCTGGAGTTTGAGGG + Intronic
991158823 5:63470469-63470491 AATTGAGCCCAGGAGTTTGAGGG + Intergenic
991523765 5:67532316-67532338 ATCGAAGTCCAGGAAATTGAGGG + Intergenic
992413609 5:76532084-76532106 ATTTTAGCATAGGAGTTTGAGGG + Intronic
993327827 5:86564398-86564420 ATTCTAGTACAGCAGTTTCATGG - Intergenic
994341773 5:98638152-98638174 ATTGTACTCTGGGAATTTGATGG - Intergenic
994346159 5:98689201-98689223 ACTGGAGCCCAGGAGGTTGAGGG + Intergenic
995561946 5:113391633-113391655 ACTTGAGTCCAGGAGTTTGGAGG + Intronic
995995408 5:118292203-118292225 ATTGAATCCCAAGAGTTTGAGGG - Intergenic
1001478591 5:172069534-172069556 ACTTGAGCCCAGGAGTTTGAGGG + Intronic
1002507343 5:179688864-179688886 ACTTGAGGCCAGGAGTTTGATGG + Intronic
1002686795 5:181018496-181018518 ATTGTGGTACAGGATGTTGATGG - Intergenic
1002788731 6:423742-423764 GTTTTTGTCCTGGAGTTTGAAGG + Intergenic
1003599480 6:7503865-7503887 ACTTAAGGCCAGGAGTTTGAGGG - Intergenic
1004365194 6:15006866-15006888 GTTTGAGCCCAGGAGTTTGAGGG + Intergenic
1006567312 6:34970923-34970945 ACTTAAGCCCAGGAGTTTGAGGG + Intronic
1006609057 6:35281851-35281873 ACTGAAACCCAGGAGTTTGAGGG + Intronic
1007621049 6:43214892-43214914 ACTTGAGTCCAGGAGTTTGAGGG + Intronic
1008929178 6:56919727-56919749 ACTTGAGCCCAGGAGTTTGAGGG + Intronic
1010076642 6:71805788-71805810 ACTGTAGTCCAGGACTTCCAAGG + Intergenic
1011061400 6:83273623-83273645 ATTATATTTCAGGAGTTTAAAGG - Intronic
1013523905 6:110957319-110957341 CTTTGAGCCCAGGAGTTTGAGGG + Intergenic
1015138664 6:129904242-129904264 ACTTGAGGCCAGGAGTTTGAGGG + Intergenic
1016556753 6:145347085-145347107 ATTCTAGTCCTGGAGTTGGGTGG + Intergenic
1018190510 6:161305752-161305774 ACTTGAGCCCAGGAGTTTGAAGG + Intergenic
1020704578 7:11528082-11528104 ATTTGAGCCCAGGAGTTTGAGGG + Intronic
1022238240 7:28483278-28483300 ATTTTAGACCAGGAATTTGTGGG + Intronic
1024127017 7:46309558-46309580 ATTGTATTCCAGGGTTTTTATGG + Intergenic
1024195475 7:47054161-47054183 ACTTGAGCCCAGGAGTTTGAGGG - Intergenic
1026973768 7:74483770-74483792 GCTTGAGTCCAGGAGTTTGAGGG + Intronic
1028293189 7:89093706-89093728 ATTGAAGTCCATGTGTCTGAAGG + Intronic
1029360942 7:100088425-100088447 ACTTGAGCCCAGGAGTTTGAGGG + Intergenic
1029484408 7:100830454-100830476 GTTTCAGTCCAGGAGTTTGAGGG + Intronic
1030386957 7:108876807-108876829 ATGATAGACCAGGAATTTGATGG + Intergenic
1030716775 7:112816714-112816736 ATTATAGAACAGGAGTTTAAGGG + Intergenic
1032549914 7:132775329-132775351 TTTGTAGTTCATGAGTTGGAAGG + Intergenic
1034115595 7:148580926-148580948 GCTGGAGCCCAGGAGTTTGAAGG + Intergenic
1034671403 7:152861682-152861704 ATTGTATTGCAGGAGCTTGGGGG + Intergenic
1035982986 8:4393663-4393685 ATTATAGTATAGGAGTGTGAAGG - Intronic
1036413950 8:8529383-8529405 GCTGGAGCCCAGGAGTTTGAGGG - Intergenic
1037594666 8:20344917-20344939 ACTTGAGTCCAGGAGTTCGAGGG + Intergenic
1038760014 8:30377325-30377347 ACTTGAGCCCAGGAGTTTGAGGG - Intergenic
1038965263 8:32564985-32565007 GCTGGAGCCCAGGAGTTTGAGGG + Intronic
1039955464 8:42203880-42203902 ACTTGAGCCCAGGAGTTTGAAGG + Intronic
1040852246 8:51913118-51913140 ATTTGAGTCCAGGAGTTTGAGGG - Intergenic
1041364596 8:57088345-57088367 AGTGTAGTCAAGGAGGGTGAGGG + Intergenic
1041442111 8:57908270-57908292 CTTGAAGTCCTGGAGTTGGAAGG - Intergenic
1042217541 8:66441317-66441339 AGGATAGCCCAGGAGTTTGAGGG - Intronic
1046407994 8:113800215-113800237 ATTTGAGCCTAGGAGTTTGAGGG - Intergenic
1050104144 9:2147914-2147936 ACTCAAGGCCAGGAGTTTGAGGG - Intronic
1055455121 9:76465063-76465085 ACTTGAGCCCAGGAGTTTGATGG - Intronic
1055794817 9:79964478-79964500 ATGCTAGTCCAGGAGTCCGAAGG + Intergenic
1056616212 9:88168235-88168257 ACTGGAGGTCAGGAGTTTGAGGG + Intergenic
1059203840 9:112444959-112444981 GTTTGAGTCCAGGACTTTGAGGG - Intronic
1061756748 9:132818763-132818785 ACTTGAGCCCAGGAGTTTGAGGG + Intronic
1186879697 X:13852861-13852883 ACTTGAGCCCAGGAGTTTGAAGG - Intronic
1187890668 X:23931747-23931769 ACTTAAGCCCAGGAGTTTGAGGG + Intronic
1188517177 X:31000075-31000097 ACTTGAGGCCAGGAGTTTGAGGG - Intergenic
1190953400 X:55168455-55168477 ATTGTAATAAAAGAGTTTGAAGG - Intronic
1192044561 X:67658540-67658562 GCTTGAGTCCAGGAGTTTGAGGG - Intronic
1192542186 X:71983526-71983548 ACTCTAGCCCAGGAGCTTGAGGG + Intergenic
1192903057 X:75521217-75521239 ATTGTAGGCCACAAGTTTAAGGG + Intronic
1193238075 X:79132712-79132734 GTTGTTGTCCAGGAGTGGGAAGG + Intergenic
1193313537 X:80037588-80037610 ATTGATGTCCAAGAGTGTGAAGG + Intergenic
1193908184 X:87268492-87268514 ACTTGAGCCCAGGAGTTTGAGGG + Intergenic
1195226400 X:102799068-102799090 ACTTGAGCCCAGGAGTTTGAGGG - Intergenic
1195263736 X:103160055-103160077 ACTTGAGCCCAGGAGTTTGAGGG + Intergenic
1195804204 X:108744736-108744758 ATTTGAGTTCAGGAGTTAGAAGG + Intergenic
1199152388 X:144502875-144502897 ATTCTAGTCTCAGAGTTTGATGG - Intergenic
1200205642 X:154313849-154313871 ACCTGAGTCCAGGAGTTTGAGGG + Intronic
1200421787 Y:2977472-2977494 ATTGTAGACCATGTGTTTTATGG - Intronic
1201503396 Y:14671446-14671468 GCTTGAGTCCAGGAGTTTGAGGG + Intronic