ID: 967366774

View in Genome Browser
Species Human (GRCh38)
Location 3:188695783-188695805
Sequence GTGCTAATTAGACCAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967366774 Original CRISPR GTGCTAATTAGACCAGAAGC TGG (reversed) Intronic
902805230 1:18857211-18857233 GTGATGATAGGACCAGAAGCAGG - Intronic
909039881 1:70636489-70636511 TTTCTAATTAGAGCAGAACCTGG + Intergenic
909561909 1:77016583-77016605 GTGCTAATTAGAGATGGAGCTGG + Intronic
909656296 1:78037134-78037156 GTTGTAATTTTACCAGAAGCAGG - Intronic
911518477 1:98898907-98898929 CTGATAATTAAACCAGAGGCAGG + Intronic
912954637 1:114146205-114146227 AGGCTAGTAAGACCAGAAGCAGG + Intronic
918055741 1:181020533-181020555 GAGGAAATGAGACCAGAAGCAGG + Intronic
920405810 1:205709388-205709410 GGGTTAATTAGGTCAGAAGCAGG + Intergenic
922309665 1:224376605-224376627 ATGCTAATCAGATTAGAAGCAGG + Exonic
924557644 1:245131258-245131280 GTGCTCTTGAGCCCAGAAGCAGG + Intergenic
1063245718 10:4216302-4216324 GTGCCAATTAGACCCGAACAGGG - Intergenic
1069131895 10:64715382-64715404 GTGCTACTTGGAACAGAATCTGG + Intergenic
1070699861 10:78593815-78593837 GTGCTATTTAGGCCAGCAACAGG + Intergenic
1079790235 11:24728409-24728431 GGCCTAACTAGAGCAGAAGCAGG - Intronic
1086946903 11:92852874-92852896 GAGGTAATTAGACCAGCAACTGG - Intronic
1091701495 12:2666318-2666340 TTGATCTTTAGACCAGAAGCGGG - Intronic
1093079948 12:14798524-14798546 CTGATATTTAGACCAGAGGCAGG + Intronic
1093620172 12:21278513-21278535 GTGCTAAGTTGCCCAGAAGTGGG - Intronic
1096805100 12:54135813-54135835 TTACTAATTAGCCCAGCAGCAGG + Intergenic
1097966419 12:65586388-65586410 GTTCTAATTTGGCCAGAAGAGGG + Intergenic
1098243253 12:68489033-68489055 GAGCTAATTATAGCAGGAGCTGG - Intergenic
1104629008 12:130383666-130383688 GTGCTAAATAGACCAGCCCCTGG + Intergenic
1115448600 14:33520042-33520064 CAACTAATTAAACCAGAAGCAGG - Intronic
1116984796 14:51206962-51206984 GTTTTAATTACTCCAGAAGCTGG - Intergenic
1117486227 14:56200277-56200299 GTGCTTATTAGCACAGAATCTGG - Intronic
1126692865 15:51301381-51301403 GTCCTAACTTGACCAGAGGCAGG + Intronic
1135200984 16:20437396-20437418 GTGCTAATAGGTACAGAAGCAGG - Intronic
1135218132 16:20590471-20590493 GTGCTAATAGGTACAGAAGCAGG + Intergenic
1136050809 16:27648610-27648632 GTGCAGATCAGAACAGAAGCTGG + Exonic
1140633398 16:76881695-76881717 GTGCTAAGTTGAGAAGAAGCTGG - Intergenic
1141346164 16:83248092-83248114 GTGCTAATGAGATCAGAGACAGG + Intronic
1143928049 17:10390695-10390717 ATGCTAAATAGACCATAAGAAGG - Intronic
1144394084 17:14826698-14826720 GAGCTAATTAGTCCATATGCAGG - Intergenic
1159035162 18:63270058-63270080 GGGCAAATTAAACCATAAGCTGG + Intronic
1166108445 19:40609044-40609066 GTGGTAGTTAGATCAGGAGCTGG + Intronic
927151589 2:20199333-20199355 ATGCTATTTAAAACAGAAGCTGG + Intergenic
929818874 2:45257883-45257905 CTGCTAATTAATCCAAAAGCTGG - Intergenic
933556374 2:83835665-83835687 ATGCTAATTAGGCAAAAAGCAGG - Intergenic
933625663 2:84595843-84595865 ATGCTAATGAGACCAAAATCAGG + Intronic
936998876 2:118443577-118443599 ATGCTAATGAGACCAGCAGTTGG + Intergenic
938768916 2:134483143-134483165 GTGCTTCCTTGACCAGAAGCTGG - Intronic
940124069 2:150304110-150304132 GTGTTCTTTAGAGCAGAAGCTGG + Intergenic
942521992 2:176814163-176814185 GTGCTAGTTAGAGCAGGACCAGG - Intergenic
944366553 2:198927894-198927916 TTGCTAATTTTGCCAGAAGCTGG - Intergenic
946355486 2:219181960-219181982 TGGCTAATCAGACCAGCAGCAGG + Intronic
1170386913 20:15829363-15829385 GTGCTAATTAAACCATCAACTGG - Intronic
1170689081 20:18595906-18595928 GTCCTTATTTGACCGGAAGCTGG + Intronic
1173282679 20:41643454-41643476 GTGATAAGGAGACCAGAAGCAGG - Intergenic
1174268539 20:49349889-49349911 GTGCTGATGAGCCCAGATGCTGG - Intergenic
1179253452 21:39694621-39694643 ATGATAGTTAGACCAGTAGCTGG - Intergenic
1180570055 22:16706346-16706368 GTTCAAGTTAGACCAGAAGTTGG - Intergenic
1182188419 22:28432472-28432494 GTGCTAATTTGAGCAGAACTCGG - Intronic
955728067 3:61953629-61953651 ATGTTAATTAGACAAGCAGCAGG - Intronic
957108521 3:75923442-75923464 GTTCAAGTTAGACCAGAAGTTGG + Intronic
957269803 3:78014895-78014917 GTGCTAATAAGACAAGAAACTGG - Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
960570743 3:119182988-119183010 GGGCTAAAGAGACAAGAAGCTGG + Intronic
960869547 3:122234817-122234839 TTGCTAATGACACCCGAAGCTGG - Intronic
962515017 3:136142165-136142187 GAGCTTATTAGTCCAGAACCTGG + Intronic
963126474 3:141821348-141821370 ATGCTAATTAGACAAAAAACAGG + Intergenic
967366774 3:188695783-188695805 GTGCTAATTAGACCAGAAGCTGG - Intronic
974552414 4:63395821-63395843 ATGCTGATTAGTCCACAAGCAGG - Intergenic
974698333 4:65404024-65404046 ATGCTAATTAAACTTGAAGCAGG + Intronic
979963664 4:127051295-127051317 TTGATAATTGGAACAGAAGCTGG - Intergenic
983870637 4:172821605-172821627 GTTATAAACAGACCAGAAGCTGG - Intronic
985671926 5:1211121-1211143 GTGCTGGTCGGACCAGAAGCCGG - Intronic
986148525 5:5104554-5104576 GTCCTAATTACACCAGAATCAGG + Intergenic
991163560 5:63533815-63533837 ATGCTAATTTGGCTAGAAGCTGG - Intergenic
992711110 5:79457425-79457447 GTGCTAAATAGACCATAAAAAGG - Intronic
998187719 5:139995538-139995560 TTGCTCTTTAGACCAGGAGCGGG + Intronic
998968684 5:147567998-147568020 GTGCTAATGAGACCACAGCCAGG - Intergenic
999343739 5:150796394-150796416 GAGCTAATTACAGCAGGAGCTGG - Exonic
1004585775 6:16998582-16998604 GTGGAAAATAGACCAGAAACTGG - Intergenic
1007530497 6:42537522-42537544 GAGCTAATTAGAGCAGAAATGGG + Intergenic
1010938935 6:81892982-81893004 CTGATAATGAGGCCAGAAGCTGG + Intergenic
1012394077 6:98775659-98775681 GTGCTAATTAGCATAGAAACTGG - Intergenic
1020240699 7:6392627-6392649 AAGCTAATTAGAGCAGTAGCTGG + Intronic
1027365944 7:77458141-77458163 GAGATAATTAGACCTGAAGGAGG + Intergenic
1028579688 7:92395301-92395323 GTGCTATTTACAACACAAGCAGG - Intronic
1031207226 7:118775866-118775888 CTGCTAATCAGAACAGATGCTGG + Intergenic
1036706980 8:11053421-11053443 GTGCTAATTAGAAAGAAAGCTGG + Intronic
1040906646 8:52475917-52475939 GGGCTAATTAGACCAGTAGAGGG + Intergenic
1044420994 8:91995667-91995689 GTTCTAACTACTCCAGAAGCTGG + Intronic
1049234430 8:141505338-141505360 CTGCCAGTGAGACCAGAAGCAGG - Intergenic
1055566457 9:77573796-77573818 GTGGTTATTAGACCAGAGGTTGG + Intronic
1059882321 9:118705317-118705339 GTGCAAAGTAGAACAGAAGGGGG + Intergenic
1060942170 9:127549107-127549129 GTTCTTATTGGAACAGAAGCTGG - Intronic
1187274694 X:17807084-17807106 GATCTAATTATACCAGAGGCCGG + Intronic
1188588811 X:31809398-31809420 GTGATAATTATTCCAGAAGTAGG + Intronic
1189265278 X:39710973-39710995 ATGCAAATGAGACTAGAAGCAGG + Intergenic
1194517280 X:94870997-94871019 GTGCTAATTAGTCCATGGGCAGG - Intergenic
1196999607 X:121424250-121424272 GTGCTTATTAGACAAGGTGCTGG + Intergenic