ID: 967369423

View in Genome Browser
Species Human (GRCh38)
Location 3:188727107-188727129
Sequence CAGAAAAGCCCAAAGTAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 292}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967369419_967369423 -9 Left 967369419 3:188727093-188727115 CCTTATCACCATCCCAGAAAAGC 0: 1
1: 0
2: 2
3: 8
4: 185
Right 967369423 3:188727107-188727129 CAGAAAAGCCCAAAGTAGCTTGG 0: 1
1: 0
2: 2
3: 22
4: 292
967369418_967369423 -8 Left 967369418 3:188727092-188727114 CCCTTATCACCATCCCAGAAAAG 0: 1
1: 0
2: 2
3: 28
4: 254
Right 967369423 3:188727107-188727129 CAGAAAAGCCCAAAGTAGCTTGG 0: 1
1: 0
2: 2
3: 22
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967369423 Original CRISPR CAGAAAAGCCCAAAGTAGCT TGG Intronic
901471938 1:9463268-9463290 AAAAAAAACACAAAGTAGCTGGG + Intergenic
902069495 1:13722363-13722385 GAGAAAGGCCCAGAGTAGCAAGG + Intronic
903045420 1:20560961-20560983 CCGAAAAGTCCAAAGGAGCTGGG + Intergenic
903481539 1:23657075-23657097 CAGAGAGGCCAAAAGTGGCTGGG + Intergenic
904079874 1:27865346-27865368 TAGAAATACACAAAGTAGCTGGG + Intergenic
904240240 1:29139602-29139624 TAGAAAATCCCAAAGAGGCTGGG - Intergenic
908213915 1:61931466-61931488 AAGAAAAGCCCAAATAGGCTGGG + Intronic
908464481 1:64378631-64378653 AAGGAAATCCCATAGTAGCTTGG + Intergenic
908492546 1:64660819-64660841 AAGAAAAGCAAAAAGTGGCTGGG - Intronic
908895145 1:68889886-68889908 CAGAAAGGCCAAAAGAAGCAGGG + Intergenic
909819827 1:80048060-80048082 CAGAAAAGGAGAAAGTAGCAGGG + Intergenic
910011917 1:82474937-82474959 TATAACAGTCCAAAGTAGCTAGG - Intergenic
910753435 1:90659486-90659508 CACAACCTCCCAAAGTAGCTGGG + Intergenic
910807115 1:91199874-91199896 CAAAAAAGCAAAAATTAGCTGGG + Intergenic
911123843 1:94322189-94322211 CAACAAAGCCCAAAATAACTAGG - Intergenic
912582817 1:110735618-110735640 CAGAAAAGGGAAAGGTAGCTGGG - Intergenic
913081378 1:115390469-115390491 ACGAAAAGCCCAAAGTGGCCAGG - Intergenic
914234857 1:145799887-145799909 ATGAAAAGCCCACAGTGGCTGGG - Intronic
914815802 1:151061132-151061154 CAGTATAGCCCACAGGAGCTAGG + Intronic
916902054 1:169236900-169236922 CAAAAAAGCACAAACTTGCTGGG + Intronic
918176801 1:182053832-182053854 CAGAAAACCAGAAAGTAGCTCGG + Intergenic
919641289 1:200047474-200047496 AAGAAAACCCCAAAGCAGTTTGG + Intronic
920004107 1:202820278-202820300 CAGAAAAACAAAAAGGAGCTGGG - Exonic
920724686 1:208423037-208423059 CAGAGAAACCAAAATTAGCTGGG - Intergenic
921436536 1:215129946-215129968 CAGAAAATCCCAAGGTTTCTAGG - Intronic
922623282 1:227008987-227009009 AAGAAAAGCTCAAAGGAGATGGG + Intronic
1063672990 10:8114856-8114878 CAAAAAAGACCCAAGAAGCTGGG - Intergenic
1064341956 10:14494878-14494900 CAAAAAAGACAAAAGTAGCCAGG + Intergenic
1064739689 10:18420078-18420100 CAGATAAGGCCAAACTGGCTGGG - Intronic
1065476185 10:26140326-26140348 CAGGAAAGCCCACAGAAGCTTGG - Intronic
1069828524 10:71268814-71268836 CAGAAAAGTCCAAAATGCCTTGG - Intronic
1071482119 10:86072627-86072649 CTCAAAAGCCCAAGGGAGCTCGG + Intronic
1071971763 10:90915212-90915234 CAGAAATGGCCAAAGCAGATTGG + Intronic
1072421881 10:95296313-95296335 CAAAAAATACGAAAGTAGCTGGG + Intergenic
1073615947 10:104995451-104995473 TAGAAAAGCTAAAATTAGCTGGG - Intronic
1075348271 10:121700744-121700766 AAGAAAAGCCCAAAGTAACATGG - Intergenic
1075403233 10:122176179-122176201 TAGAAAAGGCCAAAGTAGAATGG + Intronic
1075689602 10:124386449-124386471 TAGAGAAGCCTAAAGAAGCTGGG + Intergenic
1076400975 10:130185104-130185126 GAGAAAAGCCAGAAGGAGCTTGG + Intergenic
1076621652 10:131792840-131792862 CAGAAATTCCCAAAGAAGCCAGG + Intergenic
1077419229 11:2441848-2441870 CTGAAAATCCAAAATTAGCTGGG - Intergenic
1078469769 11:11577587-11577609 AAGTAAAGCCCAGAGAAGCTGGG + Intronic
1082836049 11:57650741-57650763 AAGAAGAGCCCAAAGTGGCCAGG - Intronic
1083760166 11:64811524-64811546 AAAAAAAGTCCCAAGTAGCTGGG + Intergenic
1085670709 11:78462050-78462072 AAGGAAGGCTCAAAGTAGCTGGG + Intronic
1086647464 11:89242366-89242388 AAAAAATGCCCAAATTAGCTGGG - Intronic
1086848928 11:91785456-91785478 TAGAAAAGCAGAAGGTAGCTGGG - Intergenic
1089142208 11:116294599-116294621 ATGAGAAGCCCAAAGTGGCTGGG - Intergenic
1089255267 11:117190635-117190657 TAGAAAAGCCCAAAGTGTTTGGG - Exonic
1089458180 11:118637644-118637666 AAGAAAAGACCAAAGTAGGCTGG - Intronic
1089720382 11:120413310-120413332 CAGAAACAACAAAAGTAGCTGGG - Intronic
1090197039 11:124825680-124825702 AAGAGAAGCCCAAAGTGGCCAGG + Intergenic
1090284058 11:125483739-125483761 CAGCAAAGCCCAAAATAGGCAGG + Intronic
1090452671 11:126820569-126820591 CAGAAAAACTTAAAGCAGCTGGG + Intronic
1091025584 11:132138014-132138036 GAGCAAAGCACAAAGGAGCTGGG - Intronic
1093236290 12:16611401-16611423 CAGCAAAGCCCAGAGGAGCTGGG - Intergenic
1094054013 12:26250159-26250181 AAGAAAAGCACATAATAGCTAGG + Intronic
1095371499 12:41473032-41473054 CAGAAAAGACAAAAGAAGTTGGG + Intronic
1095886955 12:47198667-47198689 CAGAAAATCCCAAAGAAGGCAGG + Intronic
1097151079 12:56980390-56980412 CAGAAATGCAAAAATTAGCTGGG - Intergenic
1097421371 12:59384088-59384110 AAGAAAAGCCCAAAATTCCTAGG + Intergenic
1097841239 12:64323659-64323681 CAAAAAAGCAAAAATTAGCTGGG - Intronic
1097860498 12:64514038-64514060 AAAAAAAGCAAAAAGTAGCTGGG - Intergenic
1098745935 12:74236645-74236667 ATGAGAAGCCCAAAGTGGCTGGG - Intergenic
1099525397 12:83712384-83712406 CAGAAAAACCTAAAGAAACTAGG - Intergenic
1100261216 12:92933897-92933919 GAGAAAAGTCCAGAGCAGCTGGG - Intergenic
1101729923 12:107418522-107418544 GAGAAAAGACCACAGTGGCTAGG - Intronic
1103389417 12:120560447-120560469 CAGAAAAGCTCAAACCAGCCAGG - Intronic
1103658921 12:122497846-122497868 CAGAAAAAAAAAAAGTAGCTGGG + Intronic
1104917855 12:132275239-132275261 CAGGAACTCCCTAAGTAGCTGGG + Intronic
1106061287 13:26295093-26295115 AAGAAAAGACCAAAATAGCTTGG - Intronic
1106066653 13:26358864-26358886 CACAAAAGCAAAAATTAGCTGGG + Intronic
1106215336 13:27692832-27692854 CAGCAGAGCTCAAAGTTGCTGGG - Intergenic
1108272899 13:48780123-48780145 CAGAAAAGCCCAGACTTGTTGGG + Intergenic
1108778287 13:53794820-53794842 CAAAAAAGCCCGGAATAGCTGGG + Intergenic
1109782299 13:67127604-67127626 CAGAGAAGGCCAGAGTAACTTGG - Intronic
1110242135 13:73281113-73281135 CAGAAGAACCCAAGGTGGCTAGG + Intergenic
1110430733 13:75420099-75420121 CAGAATAGGCCAAAGAAGATTGG + Intronic
1110432449 13:75440712-75440734 AAATAAAACCCAAAGTAGCTGGG - Intronic
1110856260 13:80300168-80300190 CAGAAAAGACCAAGGTAGACTGG + Intergenic
1112475595 13:99728721-99728743 CAAAAAAGCACACAGTAGCCAGG - Intronic
1112480254 13:99768806-99768828 CAGAAAAGACCTGAGAAGCTGGG - Intronic
1112684809 13:101812825-101812847 CAAAAATGCAAAAAGTAGCTGGG - Intronic
1114466558 14:22927244-22927266 CAAAAAAACACAAATTAGCTAGG - Intronic
1114709812 14:24766907-24766929 CAGAAATCCCCAAAGGAGTTTGG + Intergenic
1115797619 14:36956909-36956931 CAAAAAAGCCCAAAATTCCTAGG + Intronic
1115858566 14:37658491-37658513 TAGAAAAGCCCTGGGTAGCTGGG + Intronic
1117968847 14:61232685-61232707 CAGAAAAGCCCAAAAGGACTGGG - Intronic
1118195569 14:63622604-63622626 CAAAAAAACCAAAAGTAGCCAGG + Intronic
1118324134 14:64769952-64769974 CAGAAATCCCCAAAGAAGCCTGG + Intronic
1119486644 14:74993374-74993396 CAGAAAAACAGAAAGAAGCTGGG - Intergenic
1121150061 14:91624478-91624500 CAAAAAAGCAAAAATTAGCTGGG + Intronic
1122676055 14:103414498-103414520 GAGAAAAGTACTAAGTAGCTGGG - Intronic
1122800589 14:104227554-104227576 CAGAAACTCTCACAGTAGCTGGG + Intergenic
1126167306 15:45664577-45664599 CAGAACAGCCCAGAATAGCGTGG + Intronic
1126612066 15:50539707-50539729 CTGAAAACTGCAAAGTAGCTGGG - Intronic
1127839026 15:62813973-62813995 CAAAAAAGACAAAATTAGCTAGG - Intronic
1128196669 15:65763511-65763533 CAAAAAATACCAAAGTAGCCAGG + Intronic
1128363295 15:66977870-66977892 CAGAGAATCCCAAAGTTGCAGGG - Intergenic
1129334403 15:74843581-74843603 CAGAAAAGTGAAAAGCAGCTGGG - Intergenic
1129524114 15:76203327-76203349 CACAAAAGCCCACTGTAGGTTGG + Intronic
1130377137 15:83339186-83339208 CTGAGAAGCCCAAAGTGGCCAGG - Intergenic
1131445867 15:92497492-92497514 CAGACAAGCCCACAGGGGCTCGG + Intronic
1131724238 15:95204444-95204466 AAGAGAAGCCCAAAGTGGCCAGG - Intergenic
1131775992 15:95799233-95799255 CTAAAAATACCAAAGTAGCTAGG + Intergenic
1133715616 16:8444665-8444687 CCCAAAAGCCCAAAACAGCTAGG + Intergenic
1134743418 16:16568980-16569002 CAGAATAGCCCAAGGGAGATGGG - Intergenic
1134921503 16:18120693-18120715 GAGAGAACCCCAAAGTACCTAGG - Intergenic
1134924140 16:18143481-18143503 CAGAATAGCCCAAGGGAGATGGG + Intergenic
1136047909 16:27629850-27629872 CAAAAAATACAAAAGTAGCTGGG + Intronic
1136617421 16:31407056-31407078 CAAAAATGGCCAAATTAGCTGGG + Intronic
1137309122 16:47236018-47236040 CAGAAAAGCCCAAAGGTGCTGGG + Intronic
1139334620 16:66223157-66223179 CAGCAGAGCCTAAAGTAGCAAGG + Intergenic
1141134483 16:81456767-81456789 CAGAAAGGCCCACAGTGGCCAGG + Intronic
1141734263 16:85841611-85841633 CAGAAATGCACAAAGCGGCTGGG + Intergenic
1144958360 17:19031072-19031094 CAGAAGAGTCCACAGTAGCTTGG + Intronic
1144976798 17:19143452-19143474 CAGAAGAGTCCACAGTAGCTTGG - Intronic
1147399424 17:40171107-40171129 CAGAAAAGCTCAGAGTAGGTGGG + Exonic
1148333057 17:46823598-46823620 CAAAAAAACACAAATTAGCTGGG - Intronic
1149560597 17:57605465-57605487 CAGAAAAGCCCAGAGGCACTGGG - Intronic
1152395034 17:80027299-80027321 CAAAAAAGCAAAAATTAGCTGGG + Intronic
1153244880 18:3064014-3064036 CAAAAAATCCAAAATTAGCTGGG - Intergenic
1153294472 18:3532416-3532438 CTAAAAATACCAAAGTAGCTGGG + Intronic
1153849262 18:9077985-9078007 CAGCAGTGCCCAATGTAGCTGGG + Intergenic
1155313996 18:24552927-24552949 AAAAAATGCCCAAACTAGCTGGG + Intergenic
1155455927 18:26013014-26013036 CTGAAAATCCAAAATTAGCTGGG - Intergenic
1156493305 18:37509299-37509321 CAGAAAAGCACCACGAAGCTAGG + Intronic
1157737155 18:50059970-50059992 GAGACAAGACCACAGTAGCTGGG + Intronic
1159188287 18:65007720-65007742 CAGAATAGCCCAAATTGGCCAGG - Intergenic
1159878151 18:73833042-73833064 TTGAAAAGCCCAGAGCAGCTGGG - Intergenic
1160977599 19:1801310-1801332 CAGAAAATCGAAAATTAGCTGGG - Intronic
1161478879 19:4500919-4500941 GAGAAAAGCCCACAGCAGCCTGG - Intronic
1161738610 19:6006885-6006907 CAGAAAACCCAAAAGTGGCCGGG - Intronic
1162099652 19:8332152-8332174 CAAAAAAGCAGAAACTAGCTGGG - Intronic
1162420631 19:10564297-10564319 CTAAAAATCCCAAATTAGCTGGG + Intronic
1163396407 19:17065532-17065554 TATAAAAACCCAAAGGAGCTGGG + Intronic
1163562599 19:18029105-18029127 AAAAAAAACCCAAACTAGCTGGG + Intergenic
1164198543 19:22995596-22995618 CAGAAAATACAAAATTAGCTGGG - Intronic
1166209793 19:41298975-41298997 CACAAAAGCTCAGAGTAGGTAGG - Intronic
1167133782 19:47604815-47604837 CAAAAATGCAAAAAGTAGCTGGG - Intergenic
925751252 2:7091795-7091817 CAGAAAGGACAAAAGTAACTGGG - Intergenic
926921358 2:17943547-17943569 CAAAAAAGCAAAAATTAGCTTGG + Intronic
927127872 2:20029593-20029615 CACAAAAGACTTAAGTAGCTAGG + Intergenic
928705112 2:33941093-33941115 CAGAAAAACAAAAATTAGCTGGG + Intergenic
928843734 2:35643530-35643552 CAGGGAAGGCCAAAATAGCTGGG + Intergenic
929276639 2:40032996-40033018 GATAAAAGCACAAAGTACCTTGG + Intergenic
929615697 2:43305680-43305702 CAGAAGAGCTCAAAGGATCTGGG + Intronic
929685548 2:44030978-44031000 CAAAAAAACCTAAAGTGGCTTGG + Intergenic
929692094 2:44083385-44083407 CAGAAATGCCCAAGGCCGCTGGG - Intergenic
933247661 2:79994066-79994088 AAAAAAACCCCAAAATAGCTAGG - Intronic
933526106 2:83441648-83441670 CAGAAAAGTAGAAAGTAGTTTGG - Intergenic
937389835 2:121475589-121475611 CAGAAAAGCCTAAAGAAAATGGG - Intronic
940969300 2:159877706-159877728 CAGAAATACAAAAAGTAGCTGGG + Intronic
941298658 2:163773062-163773084 CAGAAGACCCCATAGTATCTTGG + Intergenic
941783875 2:169477946-169477968 CTAAAAACCCCAAATTAGCTGGG - Intergenic
942003889 2:171678418-171678440 AAGAAAAGCCAAGAGTGGCTGGG - Intergenic
942514672 2:176739234-176739256 CAGAAAAACAAAAATTAGCTGGG - Intergenic
942751670 2:179294828-179294850 CAGAACAGCTCCAAGTAACTCGG + Intergenic
943328710 2:186533005-186533027 CTCAAAAGCCCAAAGTGGATTGG + Intergenic
943404220 2:187460078-187460100 CAGAAAATCCCACAGTATGTGGG + Intergenic
943745531 2:191458157-191458179 CAGATAAGCTCAAAGTAGAAGGG - Intergenic
948094871 2:235325444-235325466 CAGAAAAGCCCAACCCAGCCTGG + Intergenic
948643934 2:239392192-239392214 CAGCACAGCCCAGCGTAGCTCGG - Intronic
1168787653 20:553701-553723 TAGAAAAGCCCAAAGTGGCCAGG + Intergenic
1170305404 20:14932376-14932398 GAGAAAAGGTCAAAGGAGCTGGG - Intronic
1170584736 20:17725887-17725909 CAGAAACACCCAAAGAGGCTGGG + Intronic
1170854579 20:20039320-20039342 CAGGAAAGCCTAAAGGGGCTGGG - Intronic
1171005426 20:21460885-21460907 CTGAAAATACAAAAGTAGCTGGG + Intergenic
1171345750 20:24464988-24465010 CAGCAAAGTCCATAGGAGCTAGG + Intergenic
1172383784 20:34518321-34518343 CAGAAAAGCCAAAAGAAGCCTGG - Intronic
1172892865 20:38279294-38279316 CAGAAAATACAAAATTAGCTGGG + Intronic
1173014031 20:39208902-39208924 CAGCAAAGCCCACAAAAGCTGGG - Intergenic
1174531525 20:51218155-51218177 AGGAAGAGCCCAAAGTGGCTAGG - Intergenic
1175220330 20:57412886-57412908 CAGATAAGCCTGAAGCAGCTGGG + Intergenic
1175227491 20:57453128-57453150 CAAAAAAACTTAAAGTAGCTGGG + Intergenic
1175556933 20:59870315-59870337 CAGAAAAGCCAAGAGAATCTAGG + Intronic
1177100042 21:16889637-16889659 CAGAAAAGTCAAAATTAGCTGGG - Intergenic
1177763077 21:25424845-25424867 CAGAGAAGCCTGAAGAAGCTGGG + Intergenic
1177996013 21:28098720-28098742 CTGAAAATACAAAAGTAGCTGGG - Intergenic
1178220631 21:30654218-30654240 GAGAAAAGCCCATTGTAGGTAGG + Intergenic
1178315771 21:31565577-31565599 CAAAAAACCCCAAAGTGTCTGGG - Intergenic
1183374946 22:37457660-37457682 CATAAAGGCCCAAAGAAGCTGGG + Intergenic
950542916 3:13622797-13622819 GAGATAGACCCAAAGTAGCTGGG + Intronic
950649298 3:14397226-14397248 CAGAAACTGCCAGAGTAGCTGGG + Intergenic
950649580 3:14398903-14398925 CAGAAAAGAGCAAACTAGCTAGG + Intergenic
950672539 3:14535876-14535898 GAGGAACGCCCAAAGGAGCTGGG - Intronic
951921651 3:27861216-27861238 CACAGAAGCCAAAAGTAGCAGGG + Intergenic
952539785 3:34355870-34355892 CACAACAGCCCAAAGTAGTTAGG - Intergenic
954572599 3:51654642-51654664 CAGAAAAGCCCAAAAAAGAGGGG - Intronic
955418418 3:58714217-58714239 AAGAGAAGCCCTAAGTGGCTGGG + Intergenic
955741609 3:62096841-62096863 CATTAAAGCCCAATGCAGCTAGG - Intronic
955845599 3:63159898-63159920 CATGAAACCCCAAAGCAGCTGGG + Intergenic
955992202 3:64640571-64640593 TACAAAATCCCAAAGCAGCTGGG + Intronic
956472180 3:69578752-69578774 CAGGAAACACCAAAATAGCTAGG + Intergenic
956518675 3:70079956-70079978 CAGAATAGTTCAAAGGAGCTGGG - Intergenic
956675548 3:71728870-71728892 AAGAAAGGCCCAGAGAAGCTGGG + Intronic
956845184 3:73175979-73176001 CAGAGAAGCCAATAGGAGCTGGG - Intergenic
957249105 3:77750162-77750184 CAGAAAATACAAAATTAGCTGGG - Intergenic
957874211 3:86124368-86124390 CAGCAAAGCCCAACATATCTTGG - Intergenic
958925697 3:100154809-100154831 CAAAAAATACAAAAGTAGCTAGG + Intronic
959083985 3:101832070-101832092 CAAAAAAGAACAAAGAAGCTTGG - Intronic
960077349 3:113502442-113502464 CATAAAAGCACAAAGTACATTGG + Intronic
962356416 3:134698204-134698226 CAGAGATTCCCAAAGCAGCTAGG + Intronic
964787579 3:160415208-160415230 CAGAAAATCCAAAATTAGCCAGG + Intronic
965112035 3:164438604-164438626 TAGAAAATCTCAAAGTAACTGGG + Intergenic
966645173 3:182238288-182238310 CAGAAGGGCCCAGATTAGCTGGG - Intergenic
966661605 3:182420707-182420729 ATAAAGAGCCCAAAGTAGCTGGG - Intergenic
967369423 3:188727107-188727129 CAGAAAAGCCCAAAGTAGCTTGG + Intronic
967371475 3:188751226-188751248 CACAAAAGCTAAAAGTACCTGGG + Intronic
967577593 3:191113070-191113092 CAGAAAAGAAAAAAATAGCTAGG + Intergenic
968215453 3:196885961-196885983 AAGAAAAGCCCAGCGAAGCTGGG + Exonic
969287892 4:6218094-6218116 CAGAGAAACCCAAGGAAGCTGGG - Intergenic
972315940 4:37925856-37925878 TAGAAAAGATCAAAGTAGTTTGG + Intronic
972564057 4:40254288-40254310 CAGATAAGATCAATGTAGCTGGG + Intergenic
972948387 4:44286556-44286578 TAAGAAAGCCCAATGTAGCTGGG + Intronic
973895334 4:55406821-55406843 CAAAAAATACAAAAGTAGCTGGG - Intronic
973929636 4:55778684-55778706 AAAAAAAGCCAAAATTAGCTGGG - Intergenic
975215115 4:71744296-71744318 AAAAAAAACCCAAATTAGCTGGG + Intronic
976292888 4:83439226-83439248 CTGAAAATACCAAATTAGCTGGG - Intronic
976886505 4:89991268-89991290 GAGAAAAGCCCCAAATAGCATGG - Intergenic
978501704 4:109417057-109417079 CAAAAAAGCACAAACCAGCTGGG - Intergenic
978732727 4:112049121-112049143 CAAAAAATACAAAAGTAGCTGGG + Intergenic
979597159 4:122546901-122546923 CAAATCAGCCAAAAGTAGCTAGG - Intergenic
983332373 4:166347327-166347349 CTGAAAATACCAAATTAGCTGGG - Intergenic
984487441 4:180388807-180388829 AACAAGAGCCCAAAGTAGGTTGG + Intergenic
986117929 5:4798593-4798615 AAAAAAAACCCAAAATAGCTGGG - Intergenic
987799620 5:22677101-22677123 CACAAAAGCACAAATTAGATTGG + Intronic
988372219 5:30385830-30385852 CAGAAAAGCCGAAAGAATATTGG + Intergenic
988468168 5:31511078-31511100 AAGAAAAGGCCAAAGCTGCTCGG - Exonic
988472424 5:31552200-31552222 CAGAAAAGAGCAAAGTAGGTTGG - Intronic
988793327 5:34629301-34629323 CATAAAAGCCCATAGTAGAGAGG + Intergenic
989500253 5:42158198-42158220 CATAAGAGCCCTAGGTAGCTAGG + Intergenic
989764122 5:45059195-45059217 CAGAATATCCCAAAAGAGCTGGG - Intergenic
990048048 5:51458711-51458733 CAGAAATGGCCAGAGCAGCTGGG + Intergenic
991642557 5:68769547-68769569 CAGAAAAGCCCTTAGAAGCAGGG - Intergenic
991920258 5:71649685-71649707 CAGTATAGCCCAAAGTTGTTTGG + Intronic
992904918 5:81336589-81336611 AAGAAAAGCTCAGAGTAGCAAGG - Intronic
994413392 5:99438025-99438047 CAGCAAGTCCCAAAGTAGCTTGG - Intergenic
997012963 5:129901366-129901388 CAGCAGAGGCCAAAGTAGATTGG - Intergenic
998745692 5:145257460-145257482 CAGAAAAACAAAAAGTAGGTAGG + Intergenic
1001130933 5:169062839-169062861 GAGAAATTCTCAAAGTAGCTGGG + Intronic
1001530537 5:172458313-172458335 CAGAAAAGCCCAAGTTGTCTAGG - Intergenic
1003576997 6:7306614-7306636 TAGAAAAGCCCAAGGTGACTAGG + Intronic
1004235049 6:13867953-13867975 CAGAAGAACCCAAACTATCTTGG - Intergenic
1004366822 6:15019864-15019886 CTGAAAATCCAAAATTAGCTGGG - Intergenic
1006549368 6:34808180-34808202 CTGAAAATACCAAATTAGCTGGG + Intronic
1006815551 6:36847509-36847531 CACTAAGGCCCAAAGTAGTTCGG + Intergenic
1006887179 6:37391811-37391833 CAGAAAAACAAAAATTAGCTGGG - Exonic
1008079156 6:47176926-47176948 AAGAGAAGCCCAAAGTGGCCAGG + Intergenic
1010596772 6:77773223-77773245 CAGAATAGCCAAAGGTATCTGGG + Intronic
1011033450 6:82947130-82947152 CAAAAAAGAGCAAAGTAGCTAGG + Intronic
1012370893 6:98505777-98505799 TAGAAAAGAGCAAAGTAGCCAGG + Intergenic
1014622897 6:123691470-123691492 CAGTAAAGCCCAGAGGAGCCTGG - Intergenic
1014811843 6:125895442-125895464 CAGATAAGCCAAAAGGAGATGGG + Intronic
1015871522 6:137780597-137780619 TAGAAAAGCCCAAGGGAGTTGGG - Intergenic
1016868410 6:148792403-148792425 CAGCAAACCCCAAAGTCGCCTGG + Intronic
1017469693 6:154727259-154727281 GAAAAATGCACAAAGTAGCTGGG + Intergenic
1020263104 7:6542332-6542354 AAGAAAATCCCAAAGTAGGTGGG + Intronic
1020657815 7:10948587-10948609 CAGCAAAGCCCAAAGTTGCTAGG + Intergenic
1022100122 7:27164555-27164577 AAGAACGGCCCAAAGTATCTCGG + Intronic
1022257113 7:28669920-28669942 AAGAGAAGCCCAAGGTAGCGGGG - Intronic
1023848644 7:44138531-44138553 CTGCACAGCCCCAAGTAGCTGGG + Intergenic
1024147720 7:46534274-46534296 AGGAAAAGCCCAGAGCAGCTGGG + Intergenic
1028619297 7:92806223-92806245 AAGAAAAGCCCCAACTATCTAGG - Intronic
1029582755 7:101448243-101448265 CAGAAAGGCAGAAAGCAGCTGGG - Intronic
1029643670 7:101837665-101837687 AAAAAAATCCAAAAGTAGCTGGG + Intronic
1031846512 7:126811597-126811619 CAGAAAACCTCAAAATACCTAGG - Intronic
1031855403 7:126916434-126916456 CAGAAAAAGGCAAAGTATCTTGG + Intronic
1034260892 7:149754785-149754807 CAAAAAAGCCAAAAGAGGCTGGG - Intergenic
1035927576 8:3744972-3744994 TAGTAAAGCCTAGAGTAGCTGGG + Intronic
1037340096 8:17835314-17835336 TAGAAATGCAAAAAGTAGCTGGG - Intergenic
1037494089 8:19422306-19422328 CAGCCAAGTCCCAAGTAGCTGGG + Intronic
1038957698 8:32485265-32485287 CTGAAAAGACAAAATTAGCTGGG - Intronic
1040563710 8:48547167-48547189 CAGAAAACTCAGAAGTAGCTAGG + Intergenic
1041134912 8:54747738-54747760 CAGAAATGCAAAAATTAGCTGGG + Intergenic
1041504662 8:58582688-58582710 AAGACCATCCCAAAGTAGCTAGG - Exonic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042069075 8:64910931-64910953 CAGAGAAGCACAAAGTAACCTGG + Intergenic
1042302238 8:67297416-67297438 AAAATAATCCCAAAGTAGCTGGG + Intronic
1042403004 8:68371115-68371137 AAGAGAAGCCCAAAGAAGCTTGG + Intronic
1042873112 8:73415812-73415834 CAGAAGAGCCCAAAGAAGAAGGG - Intergenic
1044389899 8:91637739-91637761 GAGAACATCCCAAAGTAGGTGGG + Intergenic
1044953230 8:97453669-97453691 CAGAAAATACAAAATTAGCTGGG + Intergenic
1045376240 8:101577271-101577293 TAGAAAAGCCCAGACAAGCTTGG - Intronic
1045548432 8:103149179-103149201 CAGAAAAGCCCAAGGCAGATGGG - Intronic
1045558810 8:103240764-103240786 CAGAAAAGGAAAAATTAGCTGGG + Intergenic
1045851322 8:106702128-106702150 CTGAAAAACACAAACTAGCTGGG - Intronic
1047727694 8:127698373-127698395 CATAAAATACCAAAGGAGCTAGG + Intergenic
1048719599 8:137308509-137308531 CAGCAAAGCCCACAGAGGCTGGG + Intergenic
1051119644 9:13737797-13737819 TAGAAAAGCCCAGACTAGGTTGG - Intergenic
1056543360 9:87593099-87593121 CGGAAGACCCCAAAGAAGCTTGG + Intronic
1057004725 9:91547163-91547185 CAGAGGAGCCCAAAGTGGCTGGG + Intergenic
1058145408 9:101405653-101405675 CAGAAAAGGCCAAAGAAGTAGGG + Intronic
1058899241 9:109427725-109427747 CACAAAAGCTCAGAGCAGCTAGG - Intronic
1059209050 9:112494581-112494603 CAGTTTAGCCCCAAGTAGCTGGG + Intronic
1061876562 9:133546993-133547015 CACAAAAGGCCAAACTGGCTGGG - Intronic
1062282571 9:135758614-135758636 CAGAAAAGGCCACAGTGCCTGGG + Intronic
1186160443 X:6771766-6771788 CAGAAAGGCCTAAAATACCTGGG - Intergenic
1186569299 X:10697389-10697411 GAGAAAAACCAAAAGAAGCTTGG + Intronic
1188252077 X:27909035-27909057 CAAAAAAAACCAAATTAGCTGGG + Intergenic
1189964000 X:46353162-46353184 CATGAGAGCCCAAAGTGGCTGGG + Intergenic
1190664295 X:52682958-52682980 CAAAAAATACCAAATTAGCTGGG - Intronic
1190675127 X:52775464-52775486 CAAAAAATACCAAATTAGCTGGG + Intronic
1191952228 X:66605006-66605028 TAGAAAAGCCCAGACAAGCTTGG + Intronic
1193531222 X:82657025-82657047 ATGAAAAGCCCAAAGTGGCAGGG + Intergenic
1194332050 X:92595267-92595289 CCAAAAAGCCCAAATTATCTTGG + Intronic
1195646164 X:107232901-107232923 CAAAAAATACAAAAGTAGCTGGG - Intronic
1197159363 X:123306708-123306730 CAAGAAAGCTCAATGTAGCTTGG - Intronic
1197504597 X:127285999-127286021 ATGAGAAGCCCAAAGTAGATGGG + Intergenic
1198170264 X:134098351-134098373 CAGAGGAGCCCAAAGTGGCCAGG - Intergenic
1198176175 X:134157899-134157921 AAGAAAAGTTCAAAGAAGCTGGG - Intergenic
1199395233 X:147329718-147329740 CAGAAAACCCCAAAATATCATGG + Intergenic
1200180846 X:154149901-154149923 GGGAACAGCCCAAATTAGCTGGG - Intronic
1200186489 X:154187015-154187037 GGGAACAGCCCAAATTAGCTGGG - Intergenic
1200192141 X:154224153-154224175 GGGAACAGCCCAAATTAGCTGGG - Intronic
1200197896 X:154261957-154261979 GGGAACAGCCCAAATTAGCTGGG - Intronic
1202081923 Y:21092498-21092520 CAGAAAAGCCTAAAGAAGGAAGG - Intergenic