ID: 967373800

View in Genome Browser
Species Human (GRCh38)
Location 3:188778496-188778518
Sequence AATCCAACCCTGCTGTAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967373797_967373800 8 Left 967373797 3:188778465-188778487 CCTTTAACCATTACATTCTGGAG 0: 1
1: 0
2: 1
3: 20
4: 143
Right 967373800 3:188778496-188778518 AATCCAACCCTGCTGTAGATAGG 0: 1
1: 0
2: 1
3: 2
4: 70
967373799_967373800 1 Left 967373799 3:188778472-188778494 CCATTACATTCTGGAGGTGTAAT 0: 1
1: 0
2: 1
3: 9
4: 103
Right 967373800 3:188778496-188778518 AATCCAACCCTGCTGTAGATAGG 0: 1
1: 0
2: 1
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967373800 Original CRISPR AATCCAACCCTGCTGTAGAT AGG Intronic
918827717 1:189347802-189347824 TATACAGCCCTGCTGTAAATAGG + Intergenic
919019421 1:192084893-192084915 AATCCAACCCTACCTTAAATGGG + Intergenic
919837273 1:201583487-201583509 ACTCCTTCCCTGCTGGAGATAGG + Intergenic
1064893322 10:20205365-20205387 ATTAAAACCCTGCTGTAGTTAGG + Intronic
1066696194 10:38080069-38080091 AATCGAACCCTGAAGAAGATGGG - Intergenic
1066996337 10:42567448-42567470 AATCGAACCCTGAAGAAGATGGG + Intergenic
1073301116 10:102471417-102471439 AGTCCAGCCCAGCTGTAGAGGGG - Intronic
1074055683 10:109921673-109921695 AATCCATCCCTCCTTTTGATGGG + Intronic
1076336012 10:129706805-129706827 AATCCACCCCTGCTGGAGATGGG + Intronic
1080921260 11:36711574-36711596 AATGCAACCCTGCTTCAGAAAGG - Intergenic
1087181242 11:95144558-95144580 AATCTGACCCTGCTCCAGATGGG + Intergenic
1090996265 11:131868522-131868544 AATCAAACCCGGCTGTAGCCTGG + Intronic
1091386713 12:100624-100646 AAGCCAACCATGTTGGAGATGGG + Intronic
1098217592 12:68236536-68236558 AATCCAACTAGGCTGTAGTTGGG + Intergenic
1098237323 12:68429936-68429958 ATTCCAACACTGCTGGACATAGG - Intergenic
1102580526 12:113883734-113883756 GATGCCATCCTGCTGTAGATGGG + Intronic
1105622429 13:22081475-22081497 AAAACGACCCTGCTGTAGCTGGG + Intergenic
1116955032 14:50914600-50914622 AAGCCAGCCCTGCTGCAGACTGG + Intronic
1116975980 14:51116509-51116531 AAACCATCCCTGATGTTGATTGG - Intergenic
1117691096 14:58307148-58307170 AAACCAACAATGCTATAGATTGG - Intronic
1119806755 14:77487296-77487318 AAAGCAAGCATGCTGTAGATTGG + Intronic
1120238271 14:81917853-81917875 AATCGAATCCTGAAGTAGATGGG + Intergenic
1121449681 14:93999164-93999186 ACATCATCCCTGCTGTAGATGGG + Intergenic
1124653581 15:31489807-31489829 ATTCCAGCCCTGCTGTTGAGGGG - Intronic
1133949000 16:10374358-10374380 AATCCAACTCTGCTTTTAATTGG + Intronic
1134101038 16:11451748-11451770 AACCCACCCCTGCTGGAGACAGG + Intronic
1139472737 16:67186922-67186944 GATCTGACCCTGCTGGAGATGGG + Intronic
1140792226 16:78402920-78402942 AATACAACCTTGCTGGAGAATGG - Intronic
1141013696 16:80427402-80427424 AATCCAGCTCTGCTGTTGAAGGG - Intergenic
1146889641 17:36498102-36498124 AATCCAAACCTGCAGCTGATTGG + Intronic
1149381229 17:56095963-56095985 ATCCCAACCCTGCTGTTTATTGG + Intergenic
1151415386 17:73958873-73958895 GATCCAGCTCTGCTGAAGATAGG + Intergenic
1153694776 18:7629243-7629265 AATCCATCCCTTCTGTGGACAGG - Intronic
1155888816 18:31241121-31241143 AATCCAATCCTGTTGGAGAGGGG + Intergenic
1157751154 18:50179665-50179687 AATGCACCCCTGCTGCTGATGGG + Intronic
1161631147 19:5356311-5356333 AATCCAACCCTGCTCAAGAGAGG + Intergenic
941738761 2:169010115-169010137 AAACCAACCCTGGTGTAATTTGG - Intronic
948815709 2:240509391-240509413 AATCCTAACCTGCTGTGGAGTGG - Exonic
1177481362 21:21693888-21693910 AATCCAGCTATGCTGTAGCTAGG - Intergenic
1181997813 22:26897042-26897064 AGTCAAAACCTGCTGTAAATTGG + Intergenic
1182497936 22:30723738-30723760 AATCTAAAACTGCTGTAAATAGG - Intronic
1183450020 22:37888429-37888451 AATCGAACCCTGAAGAAGATGGG + Exonic
1184426321 22:44411137-44411159 ATTCCAGCCCTGCTCTAGACAGG - Intergenic
954647983 3:52143116-52143138 AAGCCACCCCTAGTGTAGATTGG - Intronic
958414243 3:93855044-93855066 AATCCATCCTTGTTGTAAATTGG - Intergenic
959253845 3:103985005-103985027 AATCCAACCCTGTACTAGAAAGG + Intergenic
964227828 3:154428199-154428221 TATCCCGCCCTGCTGGAGATGGG + Intronic
965125246 3:164619399-164619421 AAACCAACCCTGATGGATATTGG + Intergenic
967373800 3:188778496-188778518 AATCCAACCCTGCTGTAGATAGG + Intronic
973087126 4:46078925-46078947 TATCCAACCTTAATGTAGATAGG - Intronic
986357385 5:6942224-6942246 AATCCAAACCTGGTCCAGATAGG - Intergenic
987555094 5:19436141-19436163 AATTCAACCCAGCTGTGGGTAGG + Intergenic
990690195 5:58355052-58355074 AATCCAGCCTTCCTGCAGATTGG - Intergenic
996777339 5:127146818-127146840 AACCCAACCAGGATGTAGATGGG + Intergenic
1008493421 6:52109032-52109054 CACCCAGCCCTGCTGCAGATTGG - Intergenic
1016733253 6:147448914-147448936 ATACCACCACTGCTGTAGATCGG + Intergenic
1017651366 6:156586073-156586095 AATCCAAGACTGATGTAGTTTGG + Intergenic
1020181790 7:5928425-5928447 AATACAATCCTGCTGTCAATTGG + Intronic
1020301142 7:6796515-6796537 AATACAATCCTGCTGTCAATTGG - Intronic
1024996489 7:55276505-55276527 AGGCCCACCCTGCTGTAGAAGGG - Intergenic
1034753094 7:153588995-153589017 AAGCCAACCCAGCTGTTGATTGG + Intergenic
1035103535 7:156421272-156421294 AATCCCACCTTGCTATAGTTTGG + Intergenic
1045401241 8:101820649-101820671 AAAGAATCCCTGCTGTAGATGGG + Intronic
1045491133 8:102670369-102670391 TATCCAACCCTGCTGGTAATGGG - Intergenic
1047442107 8:124887527-124887549 TAGCCATCCCTGCTCTAGATGGG + Intergenic
1050668334 9:7967334-7967356 AATCTAACCTTGCTGTAGGGTGG - Intergenic
1055933294 9:81581560-81581582 ACTCTAACCCTTCTGTAGCTGGG + Intergenic
1058823985 9:108758739-108758761 ATAACAACACTGCTGTAGATTGG + Intergenic
1059245750 9:112848431-112848453 AATCCAACCACGCTGAAGGTTGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1193998095 X:88391498-88391520 AATACAGCACTGTTGTAGATTGG + Intergenic
1194017810 X:88647196-88647218 AGTACAACACTGCTATAGATTGG + Intergenic
1194719744 X:97326402-97326424 AAACCAACCCTGCTTTAATTAGG - Intronic
1198300227 X:135327203-135327225 ACTCCACCCCTGCTGTATAATGG - Intronic