ID: 967373943

View in Genome Browser
Species Human (GRCh38)
Location 3:188780369-188780391
Sequence AGCAAATGGAATTCCTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967373938_967373943 21 Left 967373938 3:188780325-188780347 CCAAAATGATTCTGTAATGATGT 0: 1
1: 0
2: 0
3: 18
4: 252
Right 967373943 3:188780369-188780391 AGCAAATGGAATTCCTTTAAGGG 0: 1
1: 0
2: 3
3: 18
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967373943 Original CRISPR AGCAAATGGAATTCCTTTAA GGG Intronic
902917338 1:19646558-19646580 AGCACAGGGACTTCCTTGAATGG - Intronic
903444704 1:23414988-23415010 AGTAAAGGGATTTCTTTTAAAGG - Intronic
904806254 1:33134483-33134505 AGTAAATGGAGGGCCTTTAAAGG + Intergenic
906672049 1:47663280-47663302 GGCAAATGGACTTCATCTAAAGG - Intergenic
907535857 1:55155995-55156017 AGCAAAGGGAATTCATTACAGGG - Intronic
910905279 1:92170687-92170709 AGCAAATGTATTTCTTTTGAAGG - Intronic
910979280 1:92943249-92943271 AGCAAATGGAATTGTGTTGATGG + Intronic
911315271 1:96349320-96349342 AGCAAATGGCTTTTCTTTATAGG + Intergenic
912331529 1:108824517-108824539 AGCAAATGGAATGAGTTTGAAGG + Intronic
913416122 1:118610265-118610287 AGGAATTGAAATTCATTTAATGG + Intergenic
914865979 1:151429192-151429214 AACAAATGACATTCCTTTTATGG - Intronic
915054911 1:153119239-153119261 TTTAAATGGAATTCCTTGAATGG + Intergenic
916742255 1:167656396-167656418 GGCAAATGGAATGCTTTTACTGG + Intronic
916900428 1:169216425-169216447 AGCAAATGAAAGTCCCTAAAGGG + Intronic
917589355 1:176460619-176460641 AGCCTATGGATTTTCTTTAATGG - Intergenic
918145929 1:181755814-181755836 GGCAAAAGGAATTCTATTAAAGG - Intronic
919278767 1:195457543-195457565 AGAATATAGAATTCTTTTAAAGG + Intergenic
923747242 1:236713013-236713035 AGCAAGTAAAATTACTTTAAAGG - Intronic
1063275784 10:4566177-4566199 TGCAAATGAAATTCCTGTTAAGG + Intergenic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1066184421 10:32995324-32995346 AGCAAATGAACTGCCTTTGAAGG + Intronic
1066304204 10:34124347-34124369 AGAATATGGAATTCCTATTAGGG - Intronic
1067111752 10:43406329-43406351 AAAAAATGGAATTTATTTAAGGG - Intronic
1071133159 10:82419175-82419197 ACAAAATGGAAATCCATTAATGG + Intronic
1071302688 10:84268235-84268257 AGCAAATGAAAATCTTTGAAAGG + Intergenic
1072038658 10:91587232-91587254 AGCAATATGATTTCCTTTAATGG - Intergenic
1072511764 10:96133787-96133809 AGCAAATGGATTTCTGTTCAGGG + Intronic
1073225908 10:101918736-101918758 AACAAATGGATTTCCCTTTAAGG + Intronic
1073772964 10:106755617-106755639 AGGAAATGTAATTCCTAAAAAGG - Intronic
1076639692 10:131905941-131905963 TGAAAATGGAATGCCTTTAAAGG + Intronic
1080944978 11:36961531-36961553 AGCAAGTGGAATTTATTTTAGGG + Intergenic
1081825281 11:46044700-46044722 AGGAAATAAAATTCCTTTTAAGG + Intronic
1084360956 11:68668161-68668183 AGCAGATGAAAGTCCTGTAATGG + Intergenic
1086258924 11:84914444-84914466 AGCAAATAGATTTCTTTCAACGG + Intronic
1086580427 11:88392294-88392316 ATAAAATGGAATGCCTTCAACGG + Intergenic
1087385774 11:97466674-97466696 AAAAAATAGCATTCCTTTAAGGG + Intergenic
1087542300 11:99535095-99535117 AGCTCATCAAATTCCTTTAACGG - Intronic
1088476707 11:110247833-110247855 AGCAATTGCAATTCCTTTTAAGG - Exonic
1088480070 11:110288065-110288087 TGTAAATGGATTTCCTGTAAGGG + Intronic
1091436531 12:477847-477869 AGCAAATGGAAGTCCATTACTGG + Intronic
1092164407 12:6334109-6334131 AGCAAATCGAATTATTTTGAGGG + Exonic
1093086465 12:14870820-14870842 AGAAAAGGGAATTCCTGGAAAGG - Intronic
1097845294 12:64360011-64360033 AGCGAAAAGAATTTCTTTAAAGG + Intronic
1098606159 12:72392873-72392895 AGCAAATGGATGCCCTTAAAAGG - Intronic
1098667131 12:73178675-73178697 ACCAAATGGGATTCATTTCAGGG - Intergenic
1099125598 12:78752908-78752930 ATTAAATGGAATTCCTCAAAAGG + Intergenic
1099417575 12:82410894-82410916 AGCAAATTCAAATCCTTTAAGGG + Intronic
1105831752 13:24168670-24168692 AGCAACGGCAATTCCTTTGAAGG - Intronic
1106819625 13:33450403-33450425 ATCAAGTGGAATTCATTTTAGGG - Intergenic
1107903062 13:45037132-45037154 AACAAATGGAAGTGCTTTAAAGG - Intronic
1110457199 13:75702587-75702609 AGCAAATAACATTCCTTTAAGGG - Intronic
1110550924 13:76810588-76810610 AGCAAATGTCATTCATTTGATGG + Intergenic
1111520933 13:89402796-89402818 AGCAAATAGAAGTCTTTAAATGG - Intergenic
1112288573 13:98125356-98125378 TGCAGATGGGATTCATTTAAGGG + Intergenic
1115822621 14:37227817-37227839 AGCTCATAGAATGCCTTTAATGG + Exonic
1116352700 14:43885604-43885626 AGCACAGGGAATCCCTTCAAGGG - Intergenic
1118944778 14:70374467-70374489 AGCAAATTGATTTAATTTAAAGG + Intronic
1125062853 15:35445186-35445208 TGTGAATGGAATTCATTTAAGGG - Intronic
1125435695 15:39642933-39642955 AGAAAATAAAATTCCTCTAATGG + Intronic
1126304268 15:47237210-47237232 AGCTAATGGAATTCCATACAAGG + Intronic
1126401907 15:48280643-48280665 ACCACCTGGAAATCCTTTAATGG - Intronic
1126460206 15:48906764-48906786 AAAAAAGGGAATTCCTTGAAAGG - Intronic
1126647656 15:50891299-50891321 GGCAAATAGAATTCATTAAAAGG + Intergenic
1127191769 15:56538736-56538758 AGCATATCTAATTCCATTAATGG + Intergenic
1127586335 15:60381778-60381800 AGCAAATGTAATTAAATTAAAGG + Intronic
1127596981 15:60494909-60494931 AGCTAATTGAATTTCTCTAAGGG - Intronic
1129106982 15:73317378-73317400 AGCATAAGGAATACCTTTGAAGG - Intergenic
1138749639 16:59403175-59403197 AGCATATGGTATTCCAATAAAGG - Intergenic
1138897361 16:61223135-61223157 AAGAAATGGATTTCCATTAAAGG - Intergenic
1139239280 16:65374017-65374039 AGGAAAAGGAACTCCTTTAAGGG + Intergenic
1140333145 16:74076971-74076993 AGCAATTGGATTTCCTTTCTGGG - Intergenic
1141309093 16:82895764-82895786 AGCCAATGAAATAGCTTTAAGGG + Intronic
1144116293 17:12095358-12095380 AGCACTTAGAAATCCTTTAAAGG - Intronic
1144154787 17:12488849-12488871 AGGATATGGAGTTCCTTTATTGG - Intergenic
1144370524 17:14586057-14586079 AGCAAAGGGAAATCCCTTGAGGG + Intergenic
1145118653 17:20235664-20235686 AGCAAATGCCATTACTTTTAGGG + Intronic
1146934477 17:36804018-36804040 AGCACAAGGAATTCCTATACAGG + Intergenic
1150466677 17:65399141-65399163 AGAGAATGGAATTGATTTAAAGG + Intergenic
1151602804 17:75116708-75116730 AGGAATTGGAACTCCTCTAAGGG - Intronic
1155580582 18:27301070-27301092 AACAAATGGAATTACTTTGTAGG + Intergenic
1156647624 18:39185310-39185332 AGCAAAAGCAATTCCTACAAGGG - Intergenic
1158082031 18:53603675-53603697 AGCAAATGGTTTACCATTAATGG - Intergenic
1159387865 18:67749343-67749365 AGGAAATGAAATACATTTAAAGG - Intergenic
1161995610 19:7709600-7709622 TGCAGATGGAATTACGTTAAGGG - Intergenic
926567530 2:14493034-14493056 AGCAAATGAAATTCCAATATGGG + Intergenic
928892689 2:36222810-36222832 AGCCAGTGGAATACATTTAAGGG - Intergenic
931096649 2:58948040-58948062 TGCAAATTTAATTCCTTCAAAGG - Intergenic
931096835 2:58949876-58949898 TGCAAATTTAATTCCTTCAAGGG - Intergenic
933346322 2:81090313-81090335 AGTAAATAGTATTCTTTTAAAGG + Intergenic
933481788 2:82867497-82867519 AGCAAAGGGAAGACTTTTAAAGG - Intergenic
933683091 2:85120193-85120215 AGCAAATGGCTTTCCTGTGAGGG - Intergenic
936584923 2:113748145-113748167 TGAAAATGGAATTCTTTTCAAGG - Intronic
937618626 2:123958426-123958448 TGAAAATGGGATTGCTTTAAAGG + Intergenic
938980949 2:136526663-136526685 AACAAAAGGAATTGCTTTAAAGG - Intergenic
939342690 2:140919498-140919520 AGCAAATGGAATTTCTTTCCAGG + Intronic
939570851 2:143838352-143838374 AGTAAATGGAGTTCCTTTGCTGG - Intergenic
939697858 2:145350035-145350057 GGCAAGTGTAATACCTTTAAAGG + Intergenic
940038349 2:149331920-149331942 AGAAAATGTAATGGCTTTAAGGG - Intronic
940473579 2:154131456-154131478 AACAAATCGTATTCCTTTATAGG + Intronic
940916000 2:159256695-159256717 AGCAAATAGAATACCTTTGCTGG - Intronic
942396246 2:175552727-175552749 ACCAAAGGAAATTCCTTGAATGG + Intergenic
942672986 2:178396501-178396523 AGCATATGGAATTCCTGTGTGGG + Intronic
943443843 2:187957447-187957469 GGTAAATGGAATTTCATTAAAGG + Intergenic
946318424 2:218932779-218932801 AGTAAATGGAAATCCCTGAAGGG + Intergenic
946648494 2:221866683-221866705 ATCAAATGGTATTACATTAAAGG - Intergenic
946789580 2:223286474-223286496 AGCCACAGGAATTCCTTTCAGGG - Intergenic
947435922 2:230072068-230072090 AGCTAATGCAATTCAATTAAAGG - Intergenic
1170103791 20:12731133-12731155 AGCAAATAGAGTTCATTTCAGGG + Intergenic
1170862345 20:20118819-20118841 ATCAAATGGGATTCATTTCAGGG - Intronic
1171919416 20:31086406-31086428 ATGGAATGGAATTCCTTGAATGG + Intergenic
1171927917 20:31204565-31204587 ATGGAATGGAATTCCTTGAATGG + Intergenic
1176001149 20:62831745-62831767 AGCAAATGGACATTTTTTAAAGG + Intronic
1177685992 21:24438128-24438150 CAAAAGTGGAATTCCTTTAATGG + Intergenic
1178310940 21:31529552-31529574 AGCAAATGGATTTCCTTTCAGGG + Intronic
1179343455 21:40533899-40533921 ATCAAATGGATTTCCTTTCAGGG - Intronic
1181787402 22:25237068-25237090 GGCAAATAGAAGTCATTTAAGGG - Intergenic
1181836045 22:25609716-25609738 ATAAAATGAAATGCCTTTAATGG - Intronic
1184983142 22:48109141-48109163 AGGAAGTGGATTTCCTTAAATGG - Intergenic
1203327831 22_KI270738v1_random:44607-44629 ATCAAATGGAATTACTCAAATGG + Intergenic
949237538 3:1828152-1828174 AGCAAATGGAATGCTGTTATGGG + Intergenic
951289547 3:20858469-20858491 AGGAAATGGAATTCATTTGTGGG - Intergenic
952111536 3:30129431-30129453 GGAAAATGGAAGACCTTTAAAGG + Intergenic
954158541 3:48702610-48702632 AGCAAATGTCATCTCTTTAATGG + Intronic
954925217 3:54227958-54227980 AGCAAATGGAGCTCCTTTCTTGG + Intronic
959250177 3:103931800-103931822 AGCAAACAGAATTCATTAAACGG + Intergenic
960092549 3:113656254-113656276 AGGAAATGGTATTCCATCAAGGG - Exonic
964584163 3:158277181-158277203 AAAAAATGGAATTCCTTTTGGGG + Intronic
965480062 3:169207278-169207300 AGGATATGGAATTCCTTTCCAGG - Intronic
965915503 3:173841625-173841647 AGCAAATGAAATTGCTAAAAAGG + Intronic
966427362 3:179793753-179793775 AGCAACTGGAGTTCTTTGAAAGG - Intergenic
967373943 3:188780369-188780391 AGCAAATGGAATTCCTTTAAGGG + Intronic
967538676 3:190638911-190638933 AGACAATGGAATACCTTAAAGGG - Intronic
969212275 4:5696894-5696916 TGCAAATGTGATTCCATTAAGGG + Intronic
969499256 4:7543193-7543215 AGCAAGTGGACTTTCTTAAAAGG - Intronic
970836808 4:20418997-20419019 AGAAAATGGTATGCATTTAAGGG - Intronic
970939601 4:21615984-21616006 AACAAATGTGATTCTTTTAAAGG + Intronic
973139575 4:46749941-46749963 AGCCAATGGTATTCCTTTAATGG - Intronic
974062109 4:57044566-57044588 AGCAATTGGATGTCCTTTTAGGG - Intronic
976704080 4:88003839-88003861 ATCAATTTGAATTCTTTTAAGGG + Intergenic
976940463 4:90695650-90695672 AGCTATTGAGATTCCTTTAAAGG - Intronic
977601808 4:98941403-98941425 GGCAAATGGAAGGCCTTGAAAGG + Intergenic
980389714 4:132127238-132127260 TGAAAATGGCATTCTTTTAAAGG + Intergenic
980722360 4:136715420-136715442 AGGAAATGGCATTCTTCTAATGG - Intergenic
981313564 4:143319694-143319716 AGCAGAGGGAATTCCTAAAATGG + Intergenic
981811877 4:148784674-148784696 AACAAATGGAACTCCTTCCAGGG - Intergenic
985897653 5:2758659-2758681 TGCAAGTGGAATTCCCTTTAAGG - Intergenic
986123237 5:4862026-4862048 AGCAAATAAAATCCCTTTATCGG + Intergenic
986350701 5:6876860-6876882 AGCAAATTTCATTTCTTTAAAGG - Intergenic
986550691 5:8951388-8951410 AACAAATGGAATTTCTTTATTGG - Intergenic
992036203 5:72780235-72780257 AGTAAATGGGATTGCTTTATTGG - Intergenic
992912362 5:81408496-81408518 AGCAAATAGAATTCTTGCAAAGG + Intergenic
993228996 5:85207140-85207162 TGCAAATGGATTTCTATTAAAGG + Intergenic
993316922 5:86420226-86420248 ATTAAGTGGAATTCCTTTAAGGG - Intergenic
993317075 5:86423960-86423982 ATTAAGTGGAATTCCTTTAAGGG + Intergenic
993832703 5:92779194-92779216 AGCAAAAGGAGTTCCTGGAAAGG - Intergenic
994502556 5:100598449-100598471 GGCAAATGGAGTTCATCTAAAGG - Intergenic
995612741 5:113927340-113927362 AGCAAATAGCATTCCTTTTTTGG + Intergenic
998309164 5:141109532-141109554 AGAAAATGGAAATCCTTTTATGG - Intronic
1003493729 6:6645822-6645844 AGCAAAGGGAATTTCTTGAAAGG + Intronic
1008693920 6:54011819-54011841 AAAAAATGCAATTCCTTTATTGG - Intronic
1009901574 6:69813382-69813404 AAAATATTGAATTCCTTTAAGGG - Intergenic
1010058107 6:71588876-71588898 ACAAAATGGAATTCCTTCCATGG - Intergenic
1010484496 6:76392816-76392838 AGCAAATGGAAAACCTAAAAAGG + Intergenic
1011805230 6:91064434-91064456 AGCAATTGGAGTCCCTTAAAGGG - Intergenic
1012054288 6:94385681-94385703 AGCACATGGAAATATTTTAAAGG - Intergenic
1014683105 6:124458501-124458523 AGGAAATGGTATTCCCTCAATGG - Intronic
1014900287 6:126955148-126955170 TGCAAATGAAATTTCTGTAAAGG - Intergenic
1014977341 6:127903984-127904006 AGAATATGGAGTTCCTCTAATGG - Intronic
1015571838 6:134629918-134629940 AGGAGATGAAATCCCTTTAATGG - Intergenic
1015969962 6:138733892-138733914 AGCAATCAGATTTCCTTTAAAGG + Intergenic
1016421934 6:143894025-143894047 AAGAAATGGAATTGCTTTATAGG - Intronic
1021766640 7:23956442-23956464 GGCAAATGAAATTCCCCTAAGGG - Intergenic
1024327349 7:48119742-48119764 ATTAAATAGAATGCCTTTAAGGG - Intergenic
1030471530 7:109969619-109969641 ATCAAATGGGATTCATTCAAGGG + Intergenic
1030867480 7:114717284-114717306 AGCAAATGAAATTCCTGCACAGG - Intergenic
1031105544 7:117537749-117537771 AGAAAATGCAATTCCTTTCCTGG - Intronic
1033773657 7:144582207-144582229 ACCAAATGGAATTGCCTAAAAGG - Intronic
1035011510 7:155721080-155721102 AGCAATGAGAATTCCTTTAAAGG - Intronic
1035960869 8:4136086-4136108 AGCAAAAGGACTTCCTTTGAAGG + Intronic
1035985813 8:4430434-4430456 ACCAAATGAAATTCCTCTCAGGG - Intronic
1036179743 8:6573952-6573974 AGCAAATGAAAATCCTTTCTGGG + Intronic
1036517007 8:9453518-9453540 AGGAAAGGGAGTTTCTTTAAAGG + Intergenic
1036634598 8:10540334-10540356 AGGAAATGCAAATCCTTAAATGG + Intronic
1036730726 8:11261760-11261782 CGCAAAAGGAATTCCTCTGAAGG - Intergenic
1037356125 8:18021534-18021556 AGGAAATGTATTTCCTTTATGGG + Intronic
1037361952 8:18083760-18083782 TGCAACTAGAACTCCTTTAAAGG - Intronic
1038097462 8:24330794-24330816 ATCAATAGGAATTCCTCTAAAGG + Intronic
1039807901 8:41018061-41018083 AGCCAAGGGACTTCCTTGAATGG + Intergenic
1041380602 8:57250588-57250610 AGCAAATTGAACTCTGTTAAGGG - Intergenic
1041835482 8:62208744-62208766 AGAAAATGGACATCGTTTAAAGG + Intergenic
1041842355 8:62286820-62286842 AGCAAATGGAAATGTGTTAATGG + Intronic
1043059604 8:75483315-75483337 TGCAAATGTAATTCCTTAAGTGG + Intronic
1043372062 8:79606399-79606421 ATCAAATGGAATTGAATTAACGG - Intergenic
1044744514 8:95359003-95359025 AATAAATGCAATTCATTTAAAGG - Intergenic
1045912714 8:107428758-107428780 AACAAATGGGATTCCCATAAAGG - Intronic
1046106864 8:109676552-109676574 AGCAAATGTAAGTCATTTGAAGG + Intronic
1046363163 8:113187808-113187830 AGAAATTGGACTTCCTTTTATGG - Intronic
1047675854 8:127200808-127200830 AGCACATAGAATTCCACTAATGG + Intergenic
1048214745 8:132483784-132483806 AGTAAATGGAGTTGCTTTGATGG + Intergenic
1048589818 8:135811028-135811050 AGCAAATGGAATTCATGCCAAGG - Intergenic
1048664306 8:136643705-136643727 AGCAAAAGGAAATCATTTAAGGG - Intergenic
1049123458 8:140762334-140762356 AGCAAATGCAGTTAATTTAAAGG + Intronic
1049930203 9:448923-448945 AGTAAATGGAATTCTTTTAAGGG - Intronic
1049999517 9:1061823-1061845 AGCCAATTGGATTCCCTTAATGG - Intergenic
1051045040 9:12862854-12862876 AGAAAATGTTATTCCCTTAAAGG + Intergenic
1051794991 9:20857359-20857381 TGTAAATGGAATTCCTTTCTTGG + Intronic
1052217116 9:25980308-25980330 AGTAAATGGATTCCCTTTATCGG - Intergenic
1052424898 9:28291536-28291558 ACCAAATGGAATTTCTAGAATGG + Intronic
1052435976 9:28429711-28429733 AGAAAATGGAAGTACTTTAGTGG - Intronic
1055766470 9:79668745-79668767 AGCAAATGGAAGTCATCTACTGG + Intronic
1056007973 9:82294000-82294022 AGAAAATGGAATGACTTGAAAGG + Intergenic
1057041218 9:91848919-91848941 AGCAATTACAATTCCTTAAAAGG + Intronic
1057459613 9:95248834-95248856 AGTAAATGGGATTCTTTTGAAGG - Intronic
1058311645 9:103511012-103511034 AGTAAATGTAGTTTCTTTAATGG - Intergenic
1060143509 9:121231257-121231279 AGCAAACGGCATTCCTTCCATGG + Intronic
1060361369 9:122960844-122960866 AGCAAATGGAAATTCTGGAATGG + Intronic
1186176596 X:6931564-6931586 AGCAAATGCAATTATTTTATTGG - Intergenic
1188031282 X:25267235-25267257 GGCAACTGGAATTCTTCTAAAGG + Intergenic
1188764274 X:34073248-34073270 ATCTGATGGAATGCCTTTAAAGG + Intergenic
1189027061 X:37406733-37406755 AACAAAAGGAATTCATCTAATGG - Intronic
1189900353 X:45700109-45700131 AGCAAATGCAAAGCCCTTAACGG + Intergenic
1191936515 X:66433253-66433275 TGGAAATGGAATGCCTTTACTGG + Intergenic
1194335156 X:92637246-92637268 AACAATTGGATTTCCTTTCAGGG - Intergenic
1195052891 X:101114330-101114352 AGCAAATTGAATACTTTAAATGG - Intronic
1195265233 X:103173220-103173242 AGCATAGGTAATTCCGTTAAGGG + Intergenic
1196049506 X:111290029-111290051 GGAAAATAGAATTCCTTTCAGGG - Intergenic
1196166500 X:112540724-112540746 ATCAAAAGGTATTCCTCTAAGGG + Intergenic
1197077164 X:122365584-122365606 AGTAAATACAATACCTTTAATGG - Intergenic
1199353966 X:146838461-146838483 AGTAAATTGAATTCCTATGAAGG + Intergenic
1200643626 Y:5754284-5754306 AACAAGTGGATTTCCTTTCAGGG - Intergenic