ID: 967375232

View in Genome Browser
Species Human (GRCh38)
Location 3:188793476-188793498
Sequence CAGTATAATGAGAAAGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967375232 Original CRISPR CAGTATAATGAGAAAGTGGC CGG (reversed) Intronic
900572501 1:3365454-3365476 CAATATAAGGAGGAAGAGGCGGG - Intronic
901352734 1:8612254-8612276 CAGTGTAATGAGAGAGCTGCTGG - Intronic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
911189797 1:94936405-94936427 CATGAGAAAGAGAAAGTGGCAGG - Intergenic
913137678 1:115908717-115908739 CAGTATAATGAGACAATGTCAGG + Intergenic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
914908234 1:151763903-151763925 CAGTATAATGATTAAGGGTCAGG - Intronic
916660299 1:166917311-166917333 CAATGAAATAAGAAAGTGGCTGG - Exonic
916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG + Intergenic
917364653 1:174216779-174216801 AATTATAATGAGAAAGTGATGGG + Intronic
918414077 1:184289073-184289095 CAGTCTCATGAGACTGTGGCAGG + Intergenic
919291201 1:195633479-195633501 CAGTATATTTGGAAAGTGGGAGG - Intergenic
923728172 1:236524941-236524963 CAGTATAATGACAGAATTGCTGG + Intronic
923985201 1:239374003-239374025 CAATATAATGAGATTGTGGTAGG + Intergenic
924692478 1:246364565-246364587 CACCATAAAGTGAAAGTGGCAGG + Intronic
1063024060 10:2160558-2160580 CAATCTAATGAAAAAGAGGCCGG + Intergenic
1063396982 10:5697498-5697520 AAGCAGAATGAGAAAGTGCCTGG + Intronic
1066260567 10:33725616-33725638 CAGCATGGTGAGAAAGTAGCAGG + Intergenic
1067546226 10:47194483-47194505 CTGAATAATGAGAAAGTCTCTGG + Intergenic
1069206196 10:65689535-65689557 CAGTACACTGAAACAGTGGCTGG + Intergenic
1069712787 10:70500658-70500680 CGGTATAATGGGAAAGGTGCTGG + Intronic
1070905977 10:80073496-80073518 CAGTATAATGAGAATGGAGAAGG - Intergenic
1078224239 11:9378055-9378077 AAATATAATGAAAAATTGGCTGG + Intergenic
1078811030 11:14763449-14763471 CAGAGAAATGAGATAGTGGCCGG + Intronic
1079598224 11:22279767-22279789 CAGTATAGTGAGGAAGCAGCAGG + Exonic
1079939499 11:26660741-26660763 CAGTGTAATGGGAAAGAGGGTGG + Exonic
1080877769 11:36292319-36292341 CAATATAATGAGTGAGTGGAAGG + Intergenic
1081540429 11:44030785-44030807 CAGTGTAATGGAAAACTGGCTGG + Intergenic
1084493925 11:69492918-69492940 CTGAAAAAAGAGAAAGTGGCTGG + Intergenic
1085404992 11:76256484-76256506 TAGCATAAAGAAAAAGTGGCAGG + Intergenic
1087340666 11:96901921-96901943 GAGTATAAGGAGAAAATGGTAGG + Intergenic
1087463599 11:98476228-98476250 CAGTATGATGAATGAGTGGCAGG - Intergenic
1087687846 11:101285568-101285590 CAGTATAGAGAGAAGTTGGCTGG - Intergenic
1090736743 11:129617480-129617502 CAGGAGAAAGAGAGAGTGGCAGG - Intergenic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092846905 12:12592037-12592059 CAGGAGAAGTAGAAAGTGGCTGG - Intergenic
1093558480 12:20508126-20508148 CAGTGCAATGAGAATGTGCCTGG - Intronic
1094278341 12:28705708-28705730 CAGCATATTGTGAAACTGGCCGG - Intergenic
1094676727 12:32627863-32627885 ATGGTTAATGAGAAAGTGGCGGG + Intronic
1095161285 12:38918913-38918935 CATTATAAAAACAAAGTGGCAGG - Intergenic
1095311692 12:40705864-40705886 CAGGATCAAGAGAGAGTGGCGGG + Intronic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1104016117 12:124963571-124963593 CAGAATAAAGAAACAGTGGCCGG + Intronic
1104267500 12:127249044-127249066 CAATATAATGTGATAATGGCAGG + Intergenic
1105749745 13:23411847-23411869 GAGTATAATTAGAAAGTCACTGG - Intronic
1106376440 13:29193187-29193209 AAGTATAGTCAGAAAGTGGGAGG - Intronic
1107816661 13:44250575-44250597 CAGTTCAATGAGATGGTGGCTGG + Intergenic
1108842855 13:54642170-54642192 CAAAATAATGAGAAAGTAGCCGG + Intergenic
1110787559 13:79548589-79548611 CAGTGTAAAGAGTCAGTGGCGGG + Intronic
1110966326 13:81702308-81702330 CAGTGTAATTAGTAAGTGGTAGG + Intergenic
1111676238 13:91392482-91392504 TAGTATAATGTCAAAGTTGCAGG + Intergenic
1111729870 13:92060197-92060219 TAGTATAATGAGAAAATGGGTGG + Intronic
1112852379 13:103722675-103722697 CAGTTTAATCAGAGAGTGCCAGG - Intergenic
1112928222 13:104703710-104703732 CAGTATAAAGAGACAATGGGTGG + Intergenic
1113190338 13:107738467-107738489 TAGAAGAATGAGAAAGTGTCTGG - Intronic
1113472660 13:110557905-110557927 CAGGCTGATGAGAAAGCGGCTGG - Intronic
1114719448 14:24864927-24864949 CAGTAGAGAGAGAAGGTGGCGGG - Intronic
1116467945 14:45254667-45254689 CACCATAATGAGAAAATGGTTGG + Intergenic
1118264500 14:64281641-64281663 TAGTATAATGAGAAAGGAGAGGG - Intronic
1118284140 14:64455696-64455718 CAGTATAGTAAGAAAGTGGTAGG + Intronic
1119069130 14:71563850-71563872 CAGTATAAGAAGAAAATGCCTGG - Intronic
1119592293 14:75900835-75900857 CAGTGTTATGAGAACGAGGCAGG - Intronic
1121638158 14:95467625-95467647 GATTATAATTAGAAAGAGGCAGG + Intronic
1122712906 14:103673242-103673264 CAGTTAAATGAGAAAGTGTTTGG - Intronic
1127996851 15:64158063-64158085 CTGTATCTTGAGAGAGTGGCTGG - Intronic
1131676812 15:94678242-94678264 AAGTATACTGACAAAGTAGCTGG + Intergenic
1131712499 15:95071318-95071340 CATTATAATTAGAAAATAGCAGG + Intergenic
1135357502 16:21781784-21781806 CAATATCATAAGAAAATGGCTGG - Intergenic
1135456006 16:22597900-22597922 CAATATCATAAGAAAATGGCTGG - Intergenic
1135840358 16:25870567-25870589 TAGTGAAATGAGCAAGTGGCAGG + Intronic
1138549478 16:57739786-57739808 CAGTATAATCAGATGGTGGTGGG - Intronic
1138695618 16:58810395-58810417 CAGTATAATGAGAATTTAGAGGG - Intergenic
1140230363 16:73112758-73112780 CAGTAGACTGAGAAAGGGGAAGG + Intergenic
1140886326 16:79247062-79247084 GAGTATAATGGGCAAGTGCCGGG + Intergenic
1142572845 17:886417-886439 AAGAATCATGAGCAAGTGGCAGG - Intronic
1143934975 17:10474203-10474225 CAGAACAATGAAAAAGTGGAGGG + Intergenic
1144408371 17:14974689-14974711 CATTATCATAAGAAAGTGCCAGG + Intergenic
1144588910 17:16507124-16507146 CATAATAATGTGAATGTGGCTGG + Intergenic
1146396478 17:32471988-32472010 CAGTCTCATGAGTAAGTAGCTGG + Intronic
1146802187 17:35834322-35834344 TAGCATAATGCTAAAGTGGCAGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149540833 17:57466920-57466942 TAGTTTAATGAGAGAGTGGAGGG + Intronic
1149725471 17:58889184-58889206 CATTATAATGAAAAAGAAGCAGG - Intronic
1203165393 17_GL000205v2_random:88663-88685 TAGTCTAAGGAGAAAGAGGCCGG - Intergenic
1153573225 18:6494706-6494728 AAGAATCATGGGAAAGTGGCCGG - Intergenic
1153851169 18:9095932-9095954 CTGTATAATGAAAGAGTGGTCGG - Intergenic
1154283703 18:13031971-13031993 CAGGATAAAGGGAGAGTGGCCGG + Intronic
1156624390 18:38890900-38890922 CATGATAATGAAAAAGTTGCCGG - Intergenic
1156829378 18:41472302-41472324 AAGTATAATGAGTATGTGACAGG + Intergenic
1159157790 18:64606771-64606793 GAGAAAAATGAGAAAATGGCTGG + Intergenic
1159273908 18:66190875-66190897 CAGTATAATGGTAAGGTAGCAGG + Intergenic
1159926421 18:74273632-74273654 GAGTATATTTAGAAAGAGGCAGG - Intronic
1160117487 18:76094781-76094803 CATTCTTATGAGAGAGTGGCAGG - Intergenic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1161010172 19:1956063-1956085 CAGGAGGATGAGAAAGGGGCAGG - Intronic
1161374823 19:3933926-3933948 GAGTATAATTGGAAGGTGGCGGG - Intronic
1161585518 19:5103405-5103427 CAGGAAAATGAGAAAGCGGGCGG - Intronic
928631433 2:33196937-33196959 CATTATAATGAGAAAAGAGCGGG + Intronic
930296048 2:49555299-49555321 CAGAATAAAGAGTAAGTGGCAGG - Intergenic
931576190 2:63721569-63721591 CAGGAGAATGAGAAAGTTACTGG - Intronic
935788192 2:106568010-106568032 CAGAATAATGGGAAAGCTGCTGG + Intergenic
938616085 2:133000305-133000327 CAGTTAAATTAGAAAGAGGCAGG + Intronic
939480855 2:142745330-142745352 CAGGATAATGTGACAGAGGCTGG - Intergenic
939582992 2:143973492-143973514 TAGAAAAATGAGAAATTGGCCGG + Intronic
944386384 2:199169669-199169691 GAGTATAATGCCAAAGGGGCAGG + Intergenic
944735172 2:202556521-202556543 CAGTATACAGAGTAAGTGGAGGG + Exonic
946381950 2:219354870-219354892 CGGTATGATGAGAAAGTTTCAGG + Intergenic
1169712441 20:8580056-8580078 CAGCCTAATGAGAAGGTGGTGGG + Intronic
1173140110 20:40474541-40474563 CAGTTAAATGGCAAAGTGGCCGG + Intergenic
1173483163 20:43419340-43419362 AAGAATAATTAAAAAGTGGCTGG + Intergenic
1174648073 20:52103228-52103250 CAGTAAAATGACGAAGGGGCTGG - Intronic
1176336296 21:5602788-5602810 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176391461 21:6218160-6218182 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1176406359 21:6370416-6370438 TAGTCTAAGGAGAAAGAGGCCGG + Intergenic
1176469958 21:7098014-7098036 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176493519 21:7479792-7479814 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176507123 21:7658591-7658613 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1178874836 21:36405737-36405759 AAATTTAATGAGAAAGGGGCAGG + Intronic
1182857127 22:33527708-33527730 CAGCACAAAGAGAAAGTGACTGG + Intronic
1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG + Intergenic
1184708473 22:46232533-46232555 CAGTCTACTGAGTAAGTAGCTGG - Intronic
949532790 3:4973807-4973829 CAATATAATGGCAAAGTTGCAGG + Intergenic
950642379 3:14356713-14356735 TAGTAAAAGGAGAAACTGGCCGG + Intergenic
951781521 3:26368581-26368603 CAGTAAAAGGAGGAAGTGGGGGG + Intergenic
952037543 3:29221029-29221051 GGGTAGAATGAGAAAGGGGCAGG - Intergenic
954944875 3:54413528-54413550 AAATATAAAGAGAAAGGGGCAGG - Intronic
955480891 3:59388670-59388692 CAGAATAAAGAGGAAGTGACAGG - Intergenic
956553012 3:70482958-70482980 CTGGAGAATGAGAAAGGGGCTGG + Intergenic
956657573 3:71567162-71567184 AAGAAAAATGAGAAAGTGGACGG + Intronic
957575960 3:82008512-82008534 CAATATAGTGTGAAAGTGGATGG + Intergenic
957606671 3:82408075-82408097 CAGTAGAATGTGAAAGGGGTTGG + Intergenic
963308080 3:143676293-143676315 TAGTATAAAGAGAAATTGGTAGG - Intronic
963610071 3:147455913-147455935 AATTATAGTGAGAAAGTGCCTGG - Intronic
964181725 3:153895612-153895634 CAGAATAATGAGAATGTGGAAGG - Intergenic
966650172 3:182291798-182291820 CAGTGGGAAGAGAAAGTGGCAGG - Intergenic
967375232 3:188793476-188793498 CAGTATAATGAGAAAGTGGCCGG - Intronic
967432126 3:189397811-189397833 CATTATAATGTGAAATTGACAGG - Intergenic
968785641 4:2620550-2620572 AAGAATAATTAGCAAGTGGCAGG + Intronic
972612999 4:40672403-40672425 CAGGATAAGGAGACAGTGACGGG + Intergenic
974723754 4:65773694-65773716 CAGTATAGGGAGGAAGTGGGTGG + Intergenic
975949103 4:79746589-79746611 TAATACAATTAGAAAGTGGCAGG - Intergenic
978753589 4:112280152-112280174 CAGTATAAGCAGACAGTGTCCGG - Intronic
979150041 4:117300287-117300309 CTATATAATGAAAAAGTGGTAGG + Intergenic
979769210 4:124501768-124501790 CAGTATAATGAGAAAACTGAAGG - Intergenic
980594427 4:134934626-134934648 TAGTATACGGAGACAGTGGCAGG + Intergenic
980650808 4:135712287-135712309 CATTATAATGAGAAAAATGCCGG - Intergenic
980767850 4:137331503-137331525 CAGTATAAGAAGAAACAGGCAGG - Intergenic
981838382 4:149081688-149081710 CAGTCCAATGAGAAATTGGAAGG - Intergenic
981929207 4:150171895-150171917 CAGTCAGATGAGAGAGTGGCTGG - Intronic
982584087 4:157215241-157215263 GAGTATAATGAGAGGGTGTCTGG + Intronic
985937659 5:3109094-3109116 CTGAATAATGAGCAAATGGCAGG + Intergenic
986630938 5:9773036-9773058 CAGAAAAATAACAAAGTGGCAGG - Intergenic
987656131 5:20808643-20808665 CAGTATAAGGATATAGTGACGGG - Intergenic
987748750 5:22011183-22011205 CAGTATCCAGAGAAAATGGCTGG - Intronic
987759034 5:22134919-22134941 CAGCTTAATGAGTAAATGGCTGG - Intronic
988193457 5:27968569-27968591 CAGTAAGATTAGAAACTGGCGGG - Intergenic
988767420 5:34395277-34395299 CAGTATAAGGATATAGTGACGGG + Intergenic
991106085 5:62843569-62843591 CAAGATAATGAGGAAATGGCTGG + Intergenic
991502771 5:67293679-67293701 CAATATATTCAGACAGTGGCAGG + Intergenic
991768938 5:70020964-70020986 CAGTATCCAGAGAAAATGGCTGG - Intergenic
991848234 5:70896387-70896409 CAGTATCCAGAGAAAATGGCTGG - Intergenic
993174515 5:84466268-84466290 CAGGAGAATGAGAATGTGGTAGG + Intergenic
996074037 5:119168690-119168712 CACTAAAAAAAGAAAGTGGCTGG - Intronic
996396143 5:123016131-123016153 CAGAATAATGTGATATTGGCTGG + Intronic
997044841 5:130302581-130302603 AAAAATAATGAGGAAGTGGCCGG + Intergenic
998555343 5:143117829-143117851 AAGTTTAATGAGTAAGTAGCTGG + Intronic
999997990 5:157110565-157110587 CTATAAAATGAGAAATTGGCCGG - Intronic
1001681293 5:173558974-173558996 AAATATAAGGAGAAAGTGGGGGG - Intergenic
1003729649 6:8807234-8807256 CAGCAAGATGAGAAAGTGACTGG - Intergenic
1007207183 6:40162466-40162488 CAGTGTAATGTGATAGTGGTTGG - Intergenic
1007712488 6:43833612-43833634 CAGTTTAATTGGGAAGTGGCGGG + Intergenic
1008154406 6:47996169-47996191 CAGAATCAGGAGAGAGTGGCTGG + Intronic
1008465489 6:51825612-51825634 CATTATAGTTAGATAGTGGCTGG - Intronic
1009165913 6:60340757-60340779 CATTTTAATGAGAAAGTAGAAGG - Intergenic
1009964285 6:70562485-70562507 CAGTATAATAGGAAAGAAGCTGG + Intergenic
1011878580 6:91993619-91993641 GAGTATGTGGAGAAAGTGGCAGG + Intergenic
1012961038 6:105621930-105621952 CAGGATAAAGAGAAAGCGCCAGG - Intergenic
1012962866 6:105641068-105641090 AAGTATAATGAAAAAGTGAAGGG + Intergenic
1014416505 6:121190901-121190923 TAGTACTAGGAGAAAGTGGCGGG - Intronic
1015788841 6:136945953-136945975 CAGTGAAATGAGAACGTGGGTGG - Intergenic
1016516380 6:144897085-144897107 GGATATAATGAGAAGGTGGCTGG - Intergenic
1017585460 6:155917045-155917067 CAATATGATGAGAAAGAGGCAGG + Intergenic
1022959708 7:35414832-35414854 CAGTTGAATGAGAAAGTGGATGG + Intergenic
1027775082 7:82454914-82454936 CAGGAAAATGAGACAGAGGCTGG + Intergenic
1030171362 7:106606154-106606176 AAGGAAAATGAGACAGTGGCAGG - Intergenic
1031359897 7:120836728-120836750 CATTATAATGCAAAAGTGGCAGG - Intronic
1034013748 7:147559202-147559224 TTGTAGATTGAGAAAGTGGCTGG + Intronic
1035423011 7:158745135-158745157 CAGAATAATGAGACAGGGTCAGG + Intronic
1037929958 8:22873116-22873138 GAGTATAAAGAGAAAGGGGCTGG + Intronic
1040690830 8:49936641-49936663 AAGTGGAATGAGTAAGTGGCAGG - Intronic
1042171838 8:65999198-65999220 TAGAATAAGGAGAAAGTGGGAGG - Intergenic
1046295733 8:112217402-112217424 CAGTATCAAGAGACAGTGGGGGG + Intergenic
1046346704 8:112938293-112938315 AAGAATAAAGAGAAAGTTGCAGG - Intronic
1047293072 8:123546612-123546634 CAGTCTTATGAGGAAGTGGACGG - Intergenic
1048240654 8:132738469-132738491 CAGTATCCTAAGGAAGTGGCAGG - Intronic
1050185209 9:2965772-2965794 CAGGGTAAGGAGAGAGTGGCAGG + Intergenic
1051022432 9:12560004-12560026 CTGTAAAAAGAGAAAGTAGCAGG - Intergenic
1053315595 9:37048550-37048572 CATTATAATGATAAACTGTCAGG - Intergenic
1053320519 9:37094316-37094338 CATTATAATGATAAACTGTCAGG - Intergenic
1055574001 9:77644852-77644874 CAGCATAGGGAGAAAGTGTCAGG - Intronic
1056215515 9:84402688-84402710 CAGAATAGGGACAAAGTGGCAGG - Intergenic
1056635982 9:88331596-88331618 GAATAAAATGAGAAACTGGCCGG + Intergenic
1057856279 9:98603258-98603280 CAGGACAATGAGGAAGTTGCTGG - Intronic
1059284152 9:113158521-113158543 CAGTATAGTCAAACAGTGGCTGG + Intronic
1059554593 9:115266732-115266754 CTGTCTAATGAGTAAATGGCCGG + Intronic
1060570313 9:124632899-124632921 CTGGATAATGAGAAAGTTGTGGG + Intronic
1203425349 Un_GL000195v1:32114-32136 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1187270831 X:17777799-17777821 CAGTATAAAGATAAGTTGGCTGG - Intergenic
1190381640 X:49844863-49844885 AAGTATAATGAGACTGAGGCTGG + Intergenic
1190758936 X:53423777-53423799 CAGGAAAGTGAGGAAGTGGCTGG + Intronic
1192057196 X:67785037-67785059 CATGAGAGTGAGAAAGTGGCAGG - Intergenic
1192359549 X:70430503-70430525 CAGTCTAATGAGCAAGGGGAAGG + Intronic
1194700985 X:97113074-97113096 CACTAAAAGGAAAAAGTGGCCGG - Intronic
1194761033 X:97796187-97796209 AAGTTTAATTAGAAAGTGTCAGG - Intergenic
1194778632 X:97995793-97995815 TAGTAACGTGAGAAAGTGGCAGG + Intergenic
1196617820 X:117787424-117787446 CTGAATCATCAGAAAGTGGCGGG + Intergenic
1197530772 X:127623059-127623081 CTGTATAAGGAGAACGTGACAGG + Intergenic
1199007311 X:142716419-142716441 CAATATAGTGAGAAAATGACTGG + Intergenic
1200259125 X:154602613-154602635 CAGTGCAACGCGAAAGTGGCTGG + Intergenic