ID: 967381434

View in Genome Browser
Species Human (GRCh38)
Location 3:188863516-188863538
Sequence CAGTGTCAGGAGGAGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 805
Summary {0: 1, 1: 0, 2: 6, 3: 66, 4: 732}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967381434_967381445 19 Left 967381434 3:188863516-188863538 CCAGCCCCCTCCTCCTGACACTG 0: 1
1: 0
2: 6
3: 66
4: 732
Right 967381445 3:188863558-188863580 AGGCTACTGGTAGGCCCCACTGG 0: 1
1: 0
2: 0
3: 7
4: 61
967381434_967381446 30 Left 967381434 3:188863516-188863538 CCAGCCCCCTCCTCCTGACACTG 0: 1
1: 0
2: 6
3: 66
4: 732
Right 967381446 3:188863569-188863591 AGGCCCCACTGGAGACTGAAAGG 0: 1
1: 0
2: 0
3: 8
4: 195
967381434_967381441 -1 Left 967381434 3:188863516-188863538 CCAGCCCCCTCCTCCTGACACTG 0: 1
1: 0
2: 6
3: 66
4: 732
Right 967381441 3:188863538-188863560 GTGAGTTTTTCCTTTCTCGAAGG 0: 1
1: 0
2: 0
3: 24
4: 178
967381434_967381444 10 Left 967381434 3:188863516-188863538 CCAGCCCCCTCCTCCTGACACTG 0: 1
1: 0
2: 6
3: 66
4: 732
Right 967381444 3:188863549-188863571 CTTTCTCGAAGGCTACTGGTAGG 0: 1
1: 0
2: 0
3: 3
4: 72
967381434_967381442 6 Left 967381434 3:188863516-188863538 CCAGCCCCCTCCTCCTGACACTG 0: 1
1: 0
2: 6
3: 66
4: 732
Right 967381442 3:188863545-188863567 TTTCCTTTCTCGAAGGCTACTGG 0: 1
1: 0
2: 0
3: 17
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967381434 Original CRISPR CAGTGTCAGGAGGAGGGGGC TGG (reversed) Intronic
900551009 1:3255536-3255558 CAGTGGCACGGGGAGGGGGCGGG + Intronic
900659527 1:3775693-3775715 CTGGGTCAGGGGGAGGGGCCTGG - Intronic
901826911 1:11868071-11868093 CAGTATCAAGAGGAGGGAGAAGG - Intergenic
901932934 1:12608557-12608579 CAGGGGCAGGGGCAGGGGGCAGG - Intronic
902383194 1:16062200-16062222 AAGTGGCAGGAGGAGTGAGCAGG + Intronic
902608480 1:17582711-17582733 CGGTGCCAAGAGGAAGGGGCTGG - Intronic
902847553 1:19123865-19123887 CAGTGTCAGTAGGGGTGGGTTGG - Intronic
902870784 1:19312434-19312456 CAGCGGCCGGAGGAGAGGGCTGG - Exonic
903140752 1:21337887-21337909 CAGTGTGGGGAGGAGAGGGCAGG - Intronic
903231818 1:21926973-21926995 CAGGACCAGGAGGTGGGGGCCGG + Intronic
903232351 1:21929683-21929705 AAGTTCCAGGAGGAGTGGGCAGG - Intronic
903266796 1:22162712-22162734 CAGTGTCCGCAGGAAGGGGATGG + Intergenic
903300003 1:22372036-22372058 CAGTGCCCGGAGCAGGGGCCGGG - Intergenic
903391987 1:22971215-22971237 CATTTTGAGGAGGAGGGGGGTGG - Intergenic
903705132 1:25280035-25280057 AAGTGGGAGGATGAGGGGGCAGG + Intronic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
903987000 1:27235288-27235310 CGGAGTCAGGAAGAAGGGGCAGG + Intronic
904337829 1:29809625-29809647 CAATGGCAGGGGGCGGGGGCTGG + Intergenic
904365586 1:30009095-30009117 CAGTGGCCGGGGGAGGGGGGCGG + Intergenic
904679331 1:32217988-32218010 AAGTGTCAGAAGGAAGGAGCAGG + Intronic
904800909 1:33092406-33092428 CAGTTGCAGGAGGTTGGGGCAGG + Intronic
905044293 1:34984215-34984237 AAATCCCAGGAGGAGGGGGCTGG + Intronic
905228063 1:36492869-36492891 CTGTGGCAGGAGGATGGGGATGG + Intergenic
905300959 1:36985926-36985948 CACAGTGAGGAGGAGGGGGAGGG - Intronic
905708664 1:40082070-40082092 CATTTTGAGGAGGTGGGGGCTGG - Intronic
905855346 1:41307837-41307859 CAGAGTCAGGAGGAGGGACCAGG - Intergenic
905948370 1:41923473-41923495 CAGAGGCTGGAGGAGGTGGCGGG + Intronic
906208384 1:43998997-43999019 GAGGCTCAGGAGGAGGGTGCTGG - Intronic
906617155 1:47241264-47241286 GGGTGGCAGGAGGAGGGGGAAGG + Intergenic
907223863 1:52927238-52927260 TAGGGGCAGGAGGAGGGGGCGGG - Exonic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
907409651 1:54275083-54275105 CATAGTCTGGTGGAGGGGGCAGG - Intronic
907656160 1:56343421-56343443 CAGTGTACTGAGGAGGGGGCTGG - Intergenic
908439801 1:64142312-64142334 CAGTTTCTGGAGGGGAGGGCAGG - Intronic
908787481 1:67749545-67749567 CAGTACCAGGAGGAAGGGTCTGG + Intronic
910449567 1:87331653-87331675 CAGTGGGCGGAGGCGGGGGCTGG + Intronic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
912643499 1:111369539-111369561 TAGGGTGAGGAGAAGGGGGCAGG - Intergenic
912671246 1:111628300-111628322 CAGTGGCAGCAGGAGGGGAATGG + Intronic
912757415 1:112335946-112335968 CTATGTCAGTAGGAGAGGGCTGG - Intergenic
914247711 1:145898071-145898093 CAGTGTTGGGAGCAAGGGGCAGG + Intronic
914437417 1:147671987-147672009 CAGTCACAGGATGAGGGGGGAGG + Intergenic
915467373 1:156105423-156105445 CACTCTCAGGAGGAGTGGGGAGG - Intronic
915979374 1:160410491-160410513 CAGTGGCAGGAGGTGGCGTCTGG + Intronic
916425442 1:164675716-164675738 CAGTGTCTGGGGGCGGGGTCTGG - Intronic
916501599 1:165392372-165392394 CAGTGGAAGGAGCAGGGGACAGG - Intergenic
916508027 1:165445500-165445522 CTGTGAAAGGAGGAGGGGGTGGG + Intergenic
916716828 1:167453843-167453865 AAGCCTCCGGAGGAGGGGGCTGG - Intronic
918082960 1:181221576-181221598 CAGTGTCTGGGGGAGGCGGAGGG + Intergenic
919741097 1:200982169-200982191 CATTGTCAGAAGCAGGGTGCTGG - Intronic
920199708 1:204252076-204252098 CAGGGGCAGGGAGAGGGGGCAGG - Intronic
920509750 1:206542134-206542156 GAGGGTCAGGAGGAAGGGGTAGG - Intronic
921354291 1:214271675-214271697 TAGTGGCTGAAGGAGGGGGCTGG - Intergenic
922321884 1:224495736-224495758 AAGTGGCTGGAGGAGGGGGTCGG + Intronic
922480404 1:225936748-225936770 CAGTCTCCAGAGGAGTGGGCAGG + Exonic
1062923991 10:1300431-1300453 CAATGTCAGGAGGAGAGGCGTGG - Intronic
1063178399 10:3572542-3572564 AAATGTTAGGAGGAGGTGGCTGG - Intergenic
1063469473 10:6272836-6272858 CAGGGTCAGATGGAGGAGGCAGG + Intergenic
1063515767 10:6693623-6693645 CAGGCGCAGGAGGAGGGGGGAGG - Intergenic
1064115787 10:12576389-12576411 CACTGACCGGAGGAGGGGGAGGG + Intronic
1064551840 10:16509215-16509237 TAGTGTAAGCAGGACGGGGCAGG + Intronic
1064950505 10:20843954-20843976 CAGTGGCAGGAGGAGAGGATGGG - Intronic
1065546809 10:26829963-26829985 CAGGGTCCGGAGGATGGGGAGGG - Intronic
1065687672 10:28302667-28302689 CCTTGTGAGGAGGTGGGGGCGGG - Intronic
1066964306 10:42247398-42247420 CAGTGCCAGCAGGAGTGGGATGG + Intergenic
1067099296 10:43322992-43323014 CTGAGTCAGTTGGAGGGGGCGGG + Intergenic
1067716690 10:48695873-48695895 CAGTGTCCTGTGGAAGGGGCTGG - Intronic
1068502846 10:57861988-57862010 CAGTGTCTGGAGAAGGGAGACGG - Intergenic
1069555473 10:69394927-69394949 CTGAGACAGGAGGAGGGGCCTGG - Intronic
1070282456 10:75059642-75059664 TAGTGTCAGGGGGAGGGAGATGG + Intergenic
1070282464 10:75059671-75059693 CAGTGTGAGGAGGGGCAGGCCGG + Intergenic
1070769109 10:79071957-79071979 CAGTGACTGGGGGTGGGGGCTGG + Intronic
1070808956 10:79287944-79287966 CAGTGCCAGGGTGAGGGGGCAGG + Intronic
1070961889 10:80505251-80505273 CAGCCTCAGGAGGAGAGGGGAGG + Intronic
1071686186 10:87760237-87760259 CAGTGTTAGGGGGAGGGACCTGG + Intronic
1071712383 10:88062337-88062359 CTGTGTGAGGAGGTGGGGGATGG - Intergenic
1072442805 10:95471764-95471786 CAGTGACAGGAGGAAGTGGAAGG + Intronic
1072618000 10:97062581-97062603 CAGGGTGAGGAGGAGTCGGCAGG + Intronic
1072787718 10:98295533-98295555 CAGAGGCAGGAGGAGGGAGTTGG + Intergenic
1073115288 10:101088332-101088354 CAGAGACAGGATGAGGGGACGGG + Intergenic
1073420686 10:103421499-103421521 CTGATTCAGGAGGAGGAGGCTGG - Exonic
1074583199 10:114740919-114740941 CACTCTCAGGAGGATGAGGCAGG + Intergenic
1074767973 10:116714544-116714566 GTGTGTCTGGGGGAGGGGGCAGG - Intronic
1075278010 10:121112818-121112840 CAGAGTCCAGAGGAGGGAGCAGG + Intergenic
1075517172 10:123118354-123118376 CAGTGTCTGGTGGAGGGGAGTGG + Intergenic
1075711072 10:124530733-124530755 CAGTGTCCTGAGGAATGGGCAGG - Intronic
1076035581 10:127196425-127196447 CAGGGCCAGGAGGCGGGGGCGGG + Intronic
1076302879 10:129441327-129441349 CAGTCTCAGGACGAGGAGCCAGG - Intergenic
1076601471 10:131659377-131659399 CTGTGTCTGGAGAAGGGGCCAGG + Intergenic
1076755950 10:132571836-132571858 CGGTAGCAGGTGGAGGGGGCAGG + Intronic
1076802198 10:132835916-132835938 CAGGGGCAGGAGCAGGGGGAGGG - Intronic
1076822411 10:132945978-132946000 GAGTGTCAGCAGGAGGGGGTGGG + Intergenic
1076977418 11:184839-184861 CAGTGTTAGGAGGATTGGTCAGG - Intronic
1076996087 11:298243-298265 GAGTGTGAGGAGGGAGGGGCAGG + Exonic
1077054543 11:584549-584571 GAGGGGCAGGAGGAGGTGGCTGG + Intronic
1077384262 11:2261594-2261616 AAATGCCAGGAGGAGGGGGTGGG + Intergenic
1078470385 11:11581537-11581559 GGGTGTCATGGGGAGGGGGCAGG - Intronic
1079249158 11:18774507-18774529 TACTCTGAGGAGGAGGGGGCTGG + Intronic
1080116305 11:28624872-28624894 CAATGTTAGGAGGTGGGGCCTGG - Intergenic
1081546442 11:44075320-44075342 CTGAGCCAGGAAGAGGGGGCTGG - Intronic
1081580957 11:44351437-44351459 CAAAGTCAGGCAGAGGGGGCTGG - Intergenic
1082004463 11:47412069-47412091 CAGTGCCAGGAGTGGGGGCCTGG + Intronic
1082253229 11:50005107-50005129 CAGTGTCAGAAAGTGGGTGCAGG + Intergenic
1082674154 11:56075112-56075134 CTGTGGCAGGAGGATGGGGAGGG - Intergenic
1083544480 11:63538342-63538364 CAGGGACAGGAGGCAGGGGCTGG + Intronic
1083659371 11:64245191-64245213 CAGGGTCAAGGTGAGGGGGCTGG - Exonic
1083745985 11:64736734-64736756 CACGGTGAGGAGCAGGGGGCAGG - Exonic
1083770367 11:64863771-64863793 CAGAGTCAGTGGCAGGGGGCGGG - Intronic
1083920199 11:65778309-65778331 CAGAGGCAGGAGCAGAGGGCGGG + Exonic
1084421196 11:69061529-69061551 CAGAGAGAGGAGGTGGGGGCAGG + Intronic
1084576686 11:69993136-69993158 CTGTCTCAGGAGGGGGTGGCTGG - Intergenic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084978845 11:72817811-72817833 AAGTGGCAGGAGGAGGAGGAGGG + Exonic
1085027132 11:73242814-73242836 CAGTGGCAGGAAACGGGGGCTGG + Intergenic
1085201268 11:74703654-74703676 CAGTGTCAGGGAGAGGGGACAGG - Intronic
1085409538 11:76283033-76283055 CAGAGTCAGCAGCAGGGGCCAGG - Intergenic
1086143383 11:83523823-83523845 CAATGGCAGGGGCAGGGGGCGGG + Intronic
1086960191 11:92973337-92973359 CAGTGGCTGGGGGAGGGAGCAGG - Intronic
1087080183 11:94162724-94162746 GAGTGTCAGAAAGTGGGGGCAGG - Intronic
1087698063 11:101403540-101403562 CAGCCTAAGGAGGAGGGGACAGG + Intergenic
1087763879 11:102128992-102129014 CAGTGTCAGGAGACTGGGGAGGG - Intronic
1088500204 11:110475357-110475379 CAGAGACAGGAGGAGGGGAAAGG - Intergenic
1088582725 11:111331296-111331318 GAGGGGCAGGAGGAGGGGTCAGG - Intergenic
1088592483 11:111415552-111415574 AAATGGCAGGAGGAGGAGGCTGG + Intronic
1089606371 11:119643817-119643839 CAGTGTCGGGGGGTGGGGGTGGG + Intronic
1089642849 11:119859132-119859154 CAGGGTTAGGATGAGGGGGCAGG + Intergenic
1089741879 11:120590178-120590200 CAGGGTCATGAGTAGGGTGCAGG - Intronic
1090033582 11:123228922-123228944 CAGGGTCAGGATGAGAAGGCAGG - Intergenic
1090367303 11:126217620-126217642 TAAAGGCAGGAGGAGGGGGCAGG - Intronic
1090954060 11:131498948-131498970 CAGTGGCAGGAGGCTGGTGCTGG + Intronic
1091331535 11:134735128-134735150 CTGTGTCAGGAGGCTGGGGTGGG + Intergenic
1091331899 11:134737031-134737053 CTGTGCCAGGTGGAGGGGCCTGG - Intergenic
1091410390 12:235273-235295 CAGGGGCAGGAGGCAGGGGCAGG + Intronic
1091599438 12:1908935-1908957 CAGTGTCGTGAGGAGGAGCCGGG - Intronic
1092000418 12:5027149-5027171 CAGAGACAGAAGTAGGGGGCAGG + Intergenic
1092230343 12:6772608-6772630 CAGCCTGAGGAGGTGGGGGCGGG - Exonic
1092770598 12:11892958-11892980 CTGTGACAGTAGGAGTGGGCTGG - Exonic
1092852947 12:12647494-12647516 CAGTGTTGGGAGGTGGGGACTGG - Intergenic
1093560550 12:20533780-20533802 CAGTGTAAGAAAGTGGGGGCCGG - Intronic
1094555755 12:31497924-31497946 CAAGGGCAGGGGGAGGGGGCGGG + Intronic
1096249406 12:50018951-50018973 CAGTGTCAGGAGGCTGAGGCCGG - Intronic
1096356872 12:50948852-50948874 CAGAGCGAGGAGGAGGGGGGAGG + Intergenic
1096514757 12:52149711-52149733 AGGGGGCAGGAGGAGGGGGCAGG - Intergenic
1096559299 12:52424345-52424367 CACTGTCAGGAGGGAGAGGCTGG + Exonic
1096656951 12:53097903-53097925 CTGTCTCAGGAGGGAGGGGCAGG + Exonic
1096675703 12:53224714-53224736 AAGTGGCAGGAGGAGGGAGGAGG - Intronic
1096886151 12:54721328-54721350 GAGTGGCAGAAGGAGGGGGAGGG - Intergenic
1096886175 12:54721412-54721434 GAGTGTGAGAAGGAGGGGGAGGG - Intergenic
1097270172 12:57769216-57769238 CAGTGCCAGGAGGATGGGATAGG - Intronic
1097981620 12:65742105-65742127 CAGTGTGAGTGTGAGGGGGCCGG - Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1101068075 12:101043861-101043883 CAGTGTGAGGAGCACGGTGCTGG + Intronic
1101370967 12:104129872-104129894 TGGGGTCAGGAGGAGGGGTCAGG + Intronic
1101650617 12:106674079-106674101 GAGTGGCAGGAGGAGAGGTCTGG - Intronic
1102591393 12:113959226-113959248 GAGAGTGAGGAGGAGGGAGCCGG - Exonic
1102629895 12:114268786-114268808 CAGGGTTAGGATGAGGGTGCAGG - Intergenic
1103321400 12:120094675-120094697 CAGTGCCAGGCGGGAGGGGCAGG - Intergenic
1103413720 12:120730458-120730480 CTGTGTAGGGAGGAGGAGGCTGG + Intronic
1103969401 12:124660657-124660679 CAGTGGCAGGAGGGGCGGGGAGG - Intergenic
1103991335 12:124801280-124801302 CAGGGGCTGGGGGAGGGGGCGGG + Intronic
1104428825 12:128699842-128699864 GAGTGTCAGCAGGAGGGACCTGG + Intronic
1104715436 12:131013116-131013138 CAGGGCCAGGAGGAGGGTGAGGG - Intronic
1104814322 12:131637231-131637253 CAGTGCCAGGAGGGGTGGGGAGG + Intergenic
1104917407 12:132272970-132272992 CAATGTCAGGAGGAGGAGTGGGG - Intronic
1105332360 13:19429691-19429713 CAGAGTCGGGAGGGGGTGGCAGG + Intronic
1106232584 13:27832660-27832682 CAGGGGCTGGAGGAGGTGGCGGG + Intergenic
1107119310 13:36779406-36779428 ATGTGTCAGTAGGATGGGGCTGG - Intergenic
1108004665 13:45934624-45934646 CAGTATCAGGAAGAGGAGGCTGG + Intergenic
1108068462 13:46603289-46603311 CAGGGTCAGGAGGAGGAAACTGG - Intronic
1108147692 13:47497191-47497213 CAGTGCCTGGAGCAGGGGCCAGG - Intergenic
1108360745 13:49666146-49666168 CAGTAACAAGAGGAGGGGGTGGG + Intronic
1112441241 13:99426436-99426458 CAGTGGCAGGAGAGGGGTGCAGG - Intergenic
1112569728 13:100582789-100582811 CAGTGTCAGGACGAGAAGCCAGG + Intronic
1112576486 13:100641042-100641064 CAGTGTCAGGGGGGTGGGGGAGG - Intronic
1113159571 13:107364921-107364943 GAGTGGGAGGGGGAGGGGGCAGG - Intronic
1113425757 13:110207122-110207144 CTTGGTCAGGAGGAGGGAGCTGG - Intronic
1113665499 13:112138235-112138257 CAGAGTCAGGCTGAGTGGGCTGG + Intergenic
1113772149 13:112917185-112917207 CAGTGCCCGGGGGAGGGGTCCGG - Intronic
1113889797 13:113730003-113730025 CTGTGTCAGGATGAAGGGACGGG - Intronic
1114679884 14:24475427-24475449 CACTGGCAGGAGGTGGAGGCAGG + Intergenic
1115795765 14:36933707-36933729 CTGGGGCTGGAGGAGGGGGCTGG - Intronic
1117406806 14:55411878-55411900 CTGGGCCAGGAGGAGGGGCCTGG + Intergenic
1117763843 14:59059708-59059730 CAGGGGCAGGGGCAGGGGGCAGG + Intergenic
1117763853 14:59059727-59059749 CAGGGGCAGGGGCAGGGGGCAGG + Intergenic
1118708867 14:68503421-68503443 CAGCCTCTGGAGGAGGGGGAAGG - Intronic
1118735269 14:68696599-68696621 CAGTGAGAGGAGCAGAGGGCTGG - Intronic
1119514783 14:75239611-75239633 GAGTGGAAGGAGGAGAGGGCTGG - Intronic
1119704028 14:76773061-76773083 GAATGTGAGAAGGAGGGGGCAGG - Intronic
1119826518 14:77661255-77661277 TAGTGTCTGGTGAAGGGGGCTGG + Intergenic
1119830436 14:77697292-77697314 GAGTGCCAGCAGGAGCGGGCTGG + Intronic
1121328829 14:93036961-93036983 CATTGTTAGGGGGTGGGGGCCGG - Intronic
1121354956 14:93206786-93206808 CAGTGACCGGAGGACGGGGCGGG - Intronic
1121511531 14:94516394-94516416 CAGTGACTCGAGGAAGGGGCCGG + Intronic
1121747080 14:96305230-96305252 GTGTGTCAGGAGGTGGGGTCGGG - Intronic
1122300729 14:100729555-100729577 CAGGGCCAGGAGGACAGGGCTGG + Intronic
1122549052 14:102540096-102540118 CAGGCTCTGGAGGAGGAGGCCGG - Intergenic
1122620765 14:103056713-103056735 AAGGGGCAGGATGAGGGGGCGGG + Intronic
1122844767 14:104486882-104486904 CAGTGTCAGGAGCAGGCGAGGGG - Intronic
1122860483 14:104580270-104580292 CAGTCCCAGGAGAAGGGGGAAGG - Intronic
1122982266 14:105197090-105197112 CAGGGTCAGGTGCAAGGGGCAGG - Intergenic
1123018860 14:105388258-105388280 CAGTGTGAGGAGACGGCGGCTGG - Intronic
1123034652 14:105466952-105466974 CACTGACAGGAGGCGGGGCCAGG - Intronic
1123128612 14:105967974-105967996 CTGTGCCAGGTGGAGGGAGCAGG - Intergenic
1123409145 15:20044139-20044161 CTGTGCCAGGTGGAGGGAGCAGG - Intergenic
1123518476 15:21050847-21050869 CTGTGCCAGGTGGAGGGAGCAGG - Intergenic
1123774582 15:23566009-23566031 CAGCCTCAGGAGGAGGAGCCTGG + Exonic
1124518840 15:30393127-30393149 CAGTTGCAGGAGAAAGGGGCGGG + Intronic
1124694588 15:31853492-31853514 CAGGTTCAGGAGGTGGGTGCTGG - Intronic
1125184566 15:36915634-36915656 CAGTGGGAGGAGGAGTGGGTTGG - Intronic
1125501028 15:40240386-40240408 GTGTGTCAGGAGGAGGGGGGAGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125600842 15:40915110-40915132 CAGTGATGGGGGGAGGGGGCTGG - Intergenic
1127200681 15:56646316-56646338 CAGTCTCAGGAGGCTGAGGCAGG + Intronic
1127493091 15:59483824-59483846 GAGTCTCAGGAGGAGGGTCCAGG + Intronic
1127973902 15:63983335-63983357 CAGTTTCAGGAGGAGGAAGCGGG + Intronic
1128261607 15:66236741-66236763 CAGGGGCAGGAGGTGGGGACAGG - Intronic
1128506649 15:68277739-68277761 CAGGGCCGGGAGGAGAGGGCGGG - Intergenic
1129113197 15:73350268-73350290 CGGTGCCAGGAGGAGGGGCATGG - Intronic
1129389530 15:75213701-75213723 CAGTCTGAGGTGGTGGGGGCAGG + Intergenic
1129524958 15:76208004-76208026 GAATGTCAGGAGGAGGGTGGTGG + Intronic
1129709999 15:77816098-77816120 CTGTTTCAGAAGGAGGGGACTGG - Intronic
1129738779 15:77979904-77979926 CAGGGTCAGGAGGAGAAAGCTGG - Intergenic
1129749078 15:78047796-78047818 CAGTGTCTGGAGTGGGGGGCAGG + Intronic
1129889979 15:79065537-79065559 CATTGGCAGGAGGAAGGGGCAGG + Intronic
1130094266 15:80844387-80844409 TAATGCCAGGATGAGGGGGCAGG + Intronic
1130564301 15:84981267-84981289 CGGCGTCCGGAGGAGGTGGCGGG + Intronic
1130742507 15:86615980-86616002 GAGTTTCAGGAGGTTGGGGCAGG + Intronic
1131258457 15:90876366-90876388 GGGTGGCAGCAGGAGGGGGCTGG - Intronic
1131542201 15:93283929-93283951 CAGTGTGGGGAGGACAGGGCTGG + Intergenic
1132012722 15:98290231-98290253 CAGTGGCTGGAGGAGGGGGAGGG + Intergenic
1132223514 15:100123219-100123241 CAGTCTCAGTAGTAGAGGGCAGG + Intronic
1132331146 15:101013213-101013235 GAATTTCAGCAGGAGGGGGCTGG + Intronic
1132676587 16:1123652-1123674 CAGTGCCAGAGGGCGGGGGCAGG + Intergenic
1132699689 16:1217021-1217043 GTGTGCCAGGAGGAGGGCGCAGG - Intronic
1133225514 16:4338620-4338642 CAGTGGCTGGAGGAGGGTGCTGG + Exonic
1133228017 16:4351965-4351987 CAGGGGCTGGGGGAGGGGGCTGG - Intronic
1133234248 16:4380472-4380494 CAGGGTCTGGAAGAGGGGGCAGG - Intronic
1133234845 16:4382950-4382972 GTGTGGCAGCAGGAGGGGGCTGG - Exonic
1133388894 16:5393153-5393175 CAGAGAAAGGATGAGGGGGCAGG - Intergenic
1134001969 16:10789894-10789916 GAGGGGCAGGAGGAGGGGGCTGG + Intronic
1134521084 16:14919502-14919524 GAGTCTCAGGAGGAGGGAGGTGG + Intronic
1134550487 16:15136470-15136492 GAGTCTCAGGAGGAGGGAGGTGG - Intronic
1134708760 16:16318153-16318175 GAGTCTCAGGAGGAGGGAGGTGG + Intergenic
1134715974 16:16358187-16358209 GAGTCTCAGGAGGAGGGAGGTGG + Intergenic
1134840721 16:17399433-17399455 CAGTGTAATGAGGAGGGAGCAGG - Intronic
1134950845 16:18350492-18350514 GAGTCTCAGGAGGAGGGAGGTGG - Intergenic
1134958782 16:18393972-18393994 GAGTCTCAGGAGGAGGGAGGTGG - Intergenic
1135736210 16:24933739-24933761 AAGTGTCAGGGGGAGGGGGCTGG + Intronic
1135857998 16:26029760-26029782 CAGTTCCAGGAGAAGGGTGCTGG + Intronic
1136229911 16:28879993-28880015 CAGCGTCAGGAGGCTGGGGAGGG - Intronic
1136399736 16:30010885-30010907 CAGAGGCAGGTGCAGGGGGCTGG - Exonic
1136871659 16:33812896-33812918 CTGTGCCAGGTGGAGGGAGCAGG + Intergenic
1137667715 16:50261442-50261464 GAGAGGCAGGAGGAGGAGGCAGG + Intronic
1137707707 16:50547501-50547523 CAGTGTCCCCAGAAGGGGGCAGG + Intergenic
1138170332 16:54843611-54843633 GAGAATCAGGAGGAGGGGCCAGG - Intergenic
1138496459 16:57412011-57412033 CTGTGGCTTGAGGAGGGGGCAGG + Intronic
1138530487 16:57631798-57631820 CAGAGACAGGAGGAGGGGCAGGG - Intronic
1139429510 16:66903721-66903743 CAGGGATAGGATGAGGGGGCTGG - Intergenic
1139484094 16:67246566-67246588 GAGTGTCCGGGGGTGGGGGCGGG + Intronic
1139582189 16:67880292-67880314 CAGGATCAGCAGCAGGGGGCTGG - Intronic
1139594859 16:67951584-67951606 CAGTGTCAGGGGCTGGTGGCTGG + Intronic
1139630959 16:68231653-68231675 CAGTGTAGGAAGGAGTGGGCCGG + Exonic
1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG + Intergenic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1141352351 16:83309669-83309691 AAGTTTCAGAAGGAGGGGGCTGG - Intronic
1141558803 16:84853488-84853510 CAGTGTGGGGAGGACAGGGCTGG - Intronic
1141685103 16:85565697-85565719 CAGGGTCAGGTGAAGGGGTCAGG - Intergenic
1141790033 16:86228080-86228102 TGGTGGCAGGAGGAGGGCGCGGG - Intergenic
1141813401 16:86391973-86391995 CAGTGTCTGCTGGAGGAGGCAGG - Intergenic
1141874489 16:86813276-86813298 CAGTGTCAGGAGGAGAGCGTTGG + Intergenic
1141985152 16:87575170-87575192 CAGTGCAGGGAGGAGGGAGCAGG - Intergenic
1142242421 16:88953600-88953622 CAGTGCCAGCAGGAGTGGCCGGG + Intronic
1142252650 16:88999715-88999737 CAGAGGGAGGAGGGGGGGGCGGG + Intergenic
1142442832 16:90111845-90111867 CAGTGTTAGGAGGATTGGTCAGG + Intergenic
1203100513 16_KI270728v1_random:1303162-1303184 CTGTGCCAGGTGGAGGGAGCAGG - Intergenic
1142464869 17:129546-129568 CAGTGTTAGGAGGATTGGTCAGG - Intergenic
1142600781 17:1052526-1052548 CAGGGTCAGAGGGAGGGTGCCGG + Intronic
1142674329 17:1504308-1504330 CAGTGAGATGAGGAGGGGCCGGG + Intronic
1142717024 17:1752787-1752809 CTGGGTAAGGAGGAGGGTGCGGG + Exonic
1143028659 17:3955201-3955223 CAGTGTCAGGAAGAAGGAGGTGG - Intronic
1143122537 17:4617852-4617874 CAGTGAGGGGAGTAGGGGGCAGG - Intergenic
1143947223 17:10604065-10604087 CAATGTCAGGAGGACATGGCTGG + Intergenic
1144623688 17:16833731-16833753 GAGTGTGAGGAGCAGGTGGCTGG - Intergenic
1144882742 17:18438985-18439007 GAGTGTGAGGAGCAGGTGGCTGG + Intergenic
1145104479 17:20103751-20103773 CAGTGCCAGGAGGAAGTGGACGG - Intronic
1145123427 17:20280989-20281011 TAGTGTGAGGAGGAAGGAGCGGG + Intronic
1145149491 17:20505401-20505423 GAGTGTGAGGAGCAGGTGGCTGG - Intergenic
1145818491 17:27812652-27812674 GAGTGTCGGGAGGATGGGGGAGG + Intronic
1146134739 17:30309324-30309346 CTGAGTCAGGATGAGGGGCCAGG + Intergenic
1147035314 17:37675574-37675596 CAGTCTGGGGAGGAGGAGGCAGG - Intergenic
1147317248 17:39626890-39626912 CAGTCCCAGGCGGAGGGGACGGG + Intronic
1147462429 17:40581937-40581959 CAGGGGCAAGAGGTGGGGGCAGG - Intergenic
1147578022 17:41613663-41613685 GAGTGTGAGGAGCAGGTGGCTGG - Intronic
1147782512 17:42953841-42953863 CAGCCTCAGAAGGAGGGGCCAGG - Intronic
1147850016 17:43435188-43435210 CAGTGTCAAGGGGAGGTGGATGG + Intergenic
1148071331 17:44910554-44910576 CAGGCCCTGGAGGAGGGGGCAGG + Exonic
1148244392 17:46021022-46021044 CAGTGGCAAGAGGGGAGGGCGGG - Intronic
1148358903 17:46995872-46995894 CAGTGTAAGGAGGAGGGGCCTGG + Intronic
1148799375 17:50213751-50213773 CTGGGTCAGGAGGAGGGGGCAGG - Intergenic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149228843 17:54508221-54508243 CAGTCTCAGATGCAGGGGGCAGG + Intergenic
1149600879 17:57892303-57892325 CAGTGCCAGCACCAGGGGGCAGG + Intronic
1149684487 17:58527603-58527625 CAGTGTCTGGAGTAAGGGGTAGG - Intronic
1150321443 17:64217652-64217674 GAGTTTCAGGAGTAGAGGGCAGG - Intronic
1150613013 17:66748899-66748921 CAGCTTCAGGAGGAAGGGGAGGG + Intronic
1151497460 17:74467205-74467227 CAGGGTACGGAGGAGGGGGTGGG + Intronic
1151577209 17:74958820-74958842 CAGTGTCAGACTGAGGGGGGTGG - Intronic
1151694189 17:75705690-75705712 GGGTGTGAGGAGGAGGGGCCTGG + Intronic
1151715998 17:75831336-75831358 CAGGGTCAGGAGGCTGGGGCGGG + Exonic
1152198322 17:78930368-78930390 CAGTCTCAGGGGCAGGGAGCCGG + Intergenic
1152344273 17:79742004-79742026 CAGGGGCAGGGGCAGGGGGCCGG - Exonic
1152654217 17:81512587-81512609 CCGGGTCAGGCGGACGGGGCTGG - Exonic
1153821898 18:8839183-8839205 GAGGGGCAGGAGGAGGGGTCAGG + Intergenic
1154032712 18:10767485-10767507 CAGTGCCAAGATGATGGGGCAGG + Intronic
1154072248 18:11163144-11163166 CAATGAGAGGAGGAGGGGGAGGG - Intergenic
1154345555 18:13540949-13540971 CAGTGCCTGCAGGAAGGGGCAGG - Intronic
1155086887 18:22467603-22467625 CAGGAGCAGCAGGAGGGGGCTGG + Intergenic
1155735184 18:29212982-29213004 CAGTGTTGGGAGGTGGGGACTGG - Intergenic
1156461571 18:37324157-37324179 GACTGTCAAGAGGAGGAGGCTGG - Intronic
1156465549 18:37346175-37346197 CAGTTGGAGGAGGTGGGGGCAGG - Intronic
1156485652 18:37464000-37464022 CGGGGTCAGGAGGAGGGGCCTGG - Intronic
1157090181 18:44627635-44627657 CAGTCTCAGGAGATGGGGCCTGG + Intergenic
1157197908 18:45634651-45634673 GAGTGGCAGGAGGGGAGGGCAGG + Intronic
1158222242 18:55161643-55161665 CAGTGTTAGGATAAGAGGGCAGG - Intergenic
1158902892 18:61982854-61982876 CAGTGTTGGGAGGTGGGGCCTGG - Intergenic
1159359992 18:67387897-67387919 CAGTGTCACTAGGAGGTGGCAGG - Intergenic
1159628886 18:70726459-70726481 CAGTGTTGGGAGGTGGGGCCTGG - Intergenic
1160008930 18:75089094-75089116 CAGCGGCAGGAGGAGGCAGCTGG + Intergenic
1160021799 18:75187035-75187057 AGGAGTCAGGAGGAGGAGGCAGG - Intergenic
1160150066 18:76391885-76391907 CAGAGCCAGCAGGAGGAGGCCGG + Intronic
1160225871 18:77010031-77010053 CAGAGTGAGGAGGAGTGAGCGGG + Intronic
1160260951 18:77293858-77293880 CAGTGTTGGGAGGAGGGGTCTGG + Intergenic
1160260985 18:77294055-77294077 CAGTGTTGGGAGGTGGGGTCTGG + Intergenic
1160526186 18:79539526-79539548 CAGCTGCTGGAGGAGGGGGCAGG - Intergenic
1160583888 18:79902270-79902292 CAGTGACAGGTCGAGGGGGCTGG + Intergenic
1160751822 19:737971-737993 CGGTGCCAGGTGGAGGGGACAGG + Intronic
1161086423 19:2337661-2337683 CAGGGGCAGGAGGGGGGTGCAGG + Intronic
1161103973 19:2434244-2434266 CAGAGTGAGGAGGAGGGGCAGGG - Intronic
1161218359 19:3105980-3106002 TTGTCTCAGGAGGAGTGGGCTGG + Intronic
1161247116 19:3259269-3259291 CAGTGTCCTGGGGCGGGGGCAGG - Intronic
1161710465 19:5844642-5844664 CAGGATCAGGAGGGTGGGGCGGG + Exonic
1161768310 19:6218620-6218642 CAGCTGCAGGAGGAGGAGGCGGG - Intronic
1161900725 19:7117183-7117205 CACTGTCAGAGGGAGGAGGCGGG - Exonic
1163008698 19:14411669-14411691 CAGTGTCAGGGGGACTGGGTTGG - Intronic
1163715364 19:18869715-18869737 TAGTGTCAAGAGGTGGGGGTGGG + Intronic
1163779302 19:19238097-19238119 GAGCCTCAGGAGGAGGGGCCAGG + Intronic
1163779630 19:19239632-19239654 GAGTGGAAGGAGGAGGGGGAGGG - Intronic
1164039851 19:21484543-21484565 CAGAAACAGGAGGATGGGGCCGG - Intronic
1164430681 19:28185853-28185875 CAGCCTCATGAGGAGGAGGCTGG + Intergenic
1164668719 19:30061075-30061097 CAGTATCAGTGGGCGGGGGCTGG - Intergenic
1164674817 19:30094167-30094189 CAATGGCAGGAGGTGGGGGCAGG - Intergenic
1164732908 19:30519478-30519500 CAGCTGCAAGAGGAGGGGGCTGG + Intronic
1165079826 19:33300892-33300914 CCGTGGCAGGAGGAGGGCTCAGG - Exonic
1165389127 19:35528234-35528256 CAGTAGCAGAAGGAGGGAGCAGG + Exonic
1165422203 19:35727815-35727837 GGGTGGCAGGAGGAGAGGGCTGG + Intronic
1165450248 19:35878227-35878249 TAGGGTCCAGAGGAGGGGGCTGG - Intronic
1166301771 19:41915202-41915224 ACGTGTCCGGAGGAGGCGGCGGG - Intronic
1166409500 19:42547167-42547189 CTGTGTCTGGGGGAAGGGGCTGG + Intronic
1166632196 19:44416414-44416436 CAGTGTTAAGAGCATGGGGCTGG - Intergenic
1166708047 19:44919415-44919437 CAGGGTCTGCAGGAGAGGGCAGG + Intergenic
1166871320 19:45872758-45872780 CAGGGGCTGGAGGCGGGGGCTGG - Exonic
1166916977 19:46202048-46202070 CAGTGTGGGGAGGAGGGGAGAGG + Intergenic
1167570107 19:50281609-50281631 CGGCGCCAGGAGGAGGAGGCAGG + Exonic
1167611925 19:50511840-50511862 CAGTGGTGGGAGGAGGGGACAGG + Intronic
1167640617 19:50679186-50679208 CAGTGTGACGGGGAGGGGTCAGG + Intronic
1167786717 19:51643605-51643627 CAGGGTGAGGACGAGGGGCCAGG + Exonic
1168162516 19:54521039-54521061 GAGGGTCTGGAGTAGGGGGCTGG + Intergenic
1168185323 19:54696661-54696683 CAGGGTGAGGAGGAGGGACCTGG - Intronic
1168295928 19:55377331-55377353 CTGGGTCTGAAGGAGGGGGCTGG + Intronic
1168295954 19:55377400-55377422 CTGGGTCTGAAGGAGGGGGCTGG + Intronic
1168339316 19:55614478-55614500 CAGCGGCGGGAGGTGGGGGCCGG - Exonic
925167518 2:1727249-1727271 AAGGCTCAGGAGGAGGGAGCAGG - Intronic
925190714 2:1881137-1881159 CTGTGAGAGGAGGAGGAGGCAGG + Intronic
925749866 2:7078384-7078406 CATTGTTAGGAAGAGGTGGCTGG + Intergenic
925948909 2:8893051-8893073 CAGAGGCAGGGGGAGGGGGTGGG + Intronic
926010126 2:9400522-9400544 CCATGTCAGCAGGAGGGGACAGG - Intronic
926159156 2:10475606-10475628 CAGTGGCAGGAGGCCTGGGCCGG + Intergenic
926329399 2:11812366-11812388 CAGTGCTAGGAGGAGAGGGAAGG + Intronic
927064858 2:19461067-19461089 CAGTTGCAGGGGGAGGGGGATGG - Intergenic
927214003 2:20655986-20656008 CAGTGGGTGGAGGAGGGGACAGG + Intergenic
927700210 2:25263396-25263418 CATTGTCAAGTGGAGGAGGCAGG - Intronic
928033557 2:27801131-27801153 CAGAGGCTGGAGGACGGGGCAGG + Intronic
928115499 2:28542930-28542952 CAGTGGAAGGAGGGGGTGGCAGG - Intronic
929429043 2:41871353-41871375 CACTGGAGGGAGGAGGGGGCTGG - Intergenic
929794173 2:45046336-45046358 AAGTTTCAGGAGGAGGGTACGGG + Intergenic
930100844 2:47601599-47601621 CAGTGCGCGAAGGAGGGGGCAGG + Intergenic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
931052347 2:58428586-58428608 CGGGGGCAAGAGGAGGGGGCTGG - Intergenic
932086406 2:68766450-68766472 CAGAGACAGGCGGAGAGGGCTGG + Intronic
932347714 2:71006476-71006498 CACCTTCAGGGGGAGGGGGCTGG + Intergenic
932448250 2:71793831-71793853 TTGTGTCAGGTGGAGGGGGTTGG - Intergenic
932544070 2:72688540-72688562 CAGGGGCAGGGGCAGGGGGCAGG + Intronic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
933071067 2:77858238-77858260 CAATGTTAGGAGGTGGGGTCTGG + Intergenic
934557566 2:95295518-95295540 CAGTGAAAGGAGGATGGGGCTGG + Intergenic
934574769 2:95392925-95392947 CAGGATGAGGAGGAAGGGGCTGG + Intergenic
934731777 2:96663385-96663407 CAGTGGAGGGAGGAGGGGGCAGG + Intergenic
934882302 2:97995258-97995280 CAGTGACAGGAGACGGGGGAAGG + Intronic
934935037 2:98459270-98459292 CAGGGTAGGGAGGAGTGGGCGGG - Intronic
934949561 2:98567154-98567176 AAGTGTGAGGAGGAGGCTGCTGG + Intronic
935213203 2:100955848-100955870 GGGTGTCAGGAGCATGGGGCGGG - Intronic
936144039 2:109967288-109967310 TAGAGACAGGAGGAAGGGGCTGG - Intergenic
936180721 2:110265249-110265271 TAGAGACAGGAGGAAGGGGCTGG - Intergenic
936200648 2:110404181-110404203 TAGAGACAGGAGGAAGGGGCTGG + Intronic
936467167 2:112764159-112764181 CTGTGCCAGGAGGCGGGGTCTGG - Intronic
936555917 2:113498910-113498932 GGGTGCGAGGAGGAGGGGGCTGG + Exonic
936572609 2:113628881-113628903 GTGTGTCGGGTGGAGGGGGCAGG + Intronic
936724364 2:115294888-115294910 CTGTGTCGGGAGGAGGGGTTGGG - Intronic
936949717 2:117965756-117965778 CAGTGTCAGGTGTAGGGGGCAGG - Intronic
937704149 2:124898856-124898878 TACTGTTAGGAGGAGGAGGCCGG - Intronic
937953746 2:127407999-127408021 CAGGGGGAAGAGGAGGGGGCGGG - Intergenic
938376166 2:130808194-130808216 GAGAGCCAGGAGGAGGTGGCAGG + Intergenic
940441185 2:153718627-153718649 CAGTGACATGAGGAGGCAGCAGG + Intergenic
941014649 2:160341424-160341446 CAGTGTCAGGATGAAAGTGCCGG - Intronic
942292653 2:174487299-174487321 CCGAGGCTGGAGGAGGGGGCGGG - Intergenic
942324536 2:174764887-174764909 CAGTGTTAGGCTGAGGGTGCCGG + Intergenic
942889133 2:180965537-180965559 CTGTGTCAGGGGGTGGGGGTAGG + Intergenic
945259640 2:207831729-207831751 CACTGGAAGGAGGAGGGGGCTGG - Intronic
945522614 2:210847226-210847248 CAGTGGGATGAGGAGGAGGCTGG - Intergenic
946149366 2:217753769-217753791 CAGTAACTGGAGAAGGGGGCAGG + Intronic
946201654 2:218074020-218074042 CAGTGTGTGGAGCAGGGGACTGG + Intronic
946415303 2:219537203-219537225 CAGTGTCAGAGGGAGCGGCCGGG - Intronic
946415379 2:219537474-219537496 CAGAGTCAGGAGAAGGGGATGGG + Intronic
946418047 2:219550402-219550424 CAGTGGCAGGAGATGGGGGTGGG + Exonic
946688546 2:222294468-222294490 GAGTGGCAGGATGAGAGGGCTGG - Intronic
947165792 2:227260436-227260458 CATTGTCTGGAGGAGGGCTCTGG + Intronic
947587550 2:231365928-231365950 CAGTGCCAGTGGGAGGGGCCAGG + Intronic
947926124 2:233924135-233924157 CAGTGTCAGGAGAAGGTCCCTGG - Intronic
947952208 2:234158107-234158129 CAGTTTCAAAATGAGGGGGCTGG + Intergenic
948029057 2:234801421-234801443 CAGTTTGAGGAGAAGGGAGCAGG - Intergenic
948200000 2:236122792-236122814 TAGTGTCAGGAGGCTGAGGCAGG - Intronic
948216643 2:236237569-236237591 CTGGGTCCGGAGGCGGGGGCTGG + Intronic
948242544 2:236449509-236449531 CACAGTCCGGAGGCGGGGGCTGG + Intronic
948295483 2:236857243-236857265 GAGAGTTAAGAGGAGGGGGCGGG - Intergenic
948533145 2:238626322-238626344 CAGTCTCAGATGGAGGGGCCAGG - Intergenic
948786786 2:240356853-240356875 CAGGGTCGGCAGGAGGGGACGGG + Intergenic
948887700 2:240892353-240892375 CAGGGGCAGGGGCAGGGGGCAGG - Intronic
948928885 2:241117506-241117528 GAGTGTCAGGAGGAGGGAGAAGG + Intronic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
949032247 2:241802637-241802659 CAGAGGGAGGAGGAGGGGCCGGG + Intronic
1168804661 20:665464-665486 AAGTGGGAGGAGGAGGGGGAGGG - Intronic
1169340962 20:4795839-4795861 GAGTGCCAGGAGGAGGAGGATGG + Exonic
1169939804 20:10924769-10924791 CAGAGTCAGGAGGGGTGGGAAGG - Intergenic
1170064780 20:12299327-12299349 CAGTGGCAGCAGCTGGGGGCTGG + Intergenic
1171009857 20:21503327-21503349 CAGTTTCAGGTGGAGGTTGCAGG - Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171256642 20:23693589-23693611 CTGTGACAGGAGGAGAGGGCAGG - Intergenic
1171263994 20:23755520-23755542 CTGTGACAGGAGGAAAGGGCAGG - Intergenic
1171279533 20:23884063-23884085 CTGTGACAGGAGGAGAGGGCAGG - Intergenic
1171284606 20:23926641-23926663 CTGTGACAGGAGGAAAGGGCAGG - Intergenic
1171392621 20:24811394-24811416 CAGTGTCAGGAGGGTGGGGTAGG - Intergenic
1171459498 20:25290910-25290932 GAGGGGCAGGAGGAGAGGGCAGG - Intronic
1171459529 20:25291003-25291025 GAGGGGCAGGAGGAGAGGGCAGG - Intronic
1172056866 20:32160122-32160144 CAGGGCCAGGAGGCGGGGGAGGG + Intronic
1172093335 20:32448505-32448527 CAGTGGATGGAGGAAGGGGCTGG + Intronic
1172813787 20:37670605-37670627 CACGGTCAGGAAGAGGCGGCTGG - Intergenic
1172914692 20:38434870-38434892 CAATGCCAGGAGTCGGGGGCGGG + Intergenic
1173228377 20:41175283-41175305 CACTGTCAGGAATGGGGGGCGGG + Exonic
1173547996 20:43914340-43914362 CAGTGAGACGAGGAGGGGGCGGG + Intergenic
1173571730 20:44081531-44081553 CCCTGACAGGAGGAGGGGACTGG + Intergenic
1174174338 20:48635569-48635591 CAGTGTGAGGAAGAGTGTGCGGG - Intronic
1174289794 20:49499962-49499984 CCTTGTCAGGAAGAGGAGGCTGG - Intergenic
1174292566 20:49519490-49519512 AAGGGTGAGGAGGAGGGGCCAGG - Intronic
1174375647 20:50124905-50124927 CTGTGTCATGAGGGGTGGGCTGG + Exonic
1175188235 20:57194235-57194257 CACTGTCAAGATGATGGGGCCGG + Intronic
1175224979 20:57439458-57439480 CACTGGCAGGAGGTGGGGCCAGG + Intergenic
1175378841 20:58548807-58548829 CAGTGTTTGGGGGAGGGGGTTGG - Intergenic
1175525637 20:59631526-59631548 CAGAGGCAGGAGGGGTGGGCAGG + Intronic
1175601343 20:60276267-60276289 CAGGGTAGGGAGGAGGGAGCTGG - Intergenic
1175713028 20:61236262-61236284 AAGTGTCAGGAGGATGGGCGAGG - Intergenic
1175802472 20:61808785-61808807 CAGTCAAAGGTGGAGGGGGCAGG - Intronic
1175940121 20:62533909-62533931 CAGTGTCTGTGGGTGGGGGCAGG + Intergenic
1176057183 20:63154949-63154971 CAGTGTGGGGAGGAGGGAGGAGG - Intergenic
1176450597 21:6858431-6858453 CGGTGTCCGGGGAAGGGGGCGGG - Intergenic
1176828767 21:13723449-13723471 CGGTGTCCGGGGAAGGGGGCGGG - Intergenic
1177683899 21:24411594-24411616 CAGTGACAGGACAAAGGGGCAGG - Intergenic
1177970675 21:27785767-27785789 TAGTGTCAGGAGGAGAGGAGAGG - Intergenic
1178376393 21:32071021-32071043 CAGAGGCAGGAGGTGAGGGCAGG - Intergenic
1178789774 21:35689213-35689235 CACTGTCAGGAGATTGGGGCTGG + Intronic
1178976594 21:37226249-37226271 CAGTGTGAGGAGGGGTGGGAAGG + Intronic
1179046631 21:37850556-37850578 CAGGGGCAGGAGGAGGGGGTGGG - Intronic
1179176565 21:39011985-39012007 CAGTGTGGGGAGGTGGGTGCAGG + Intergenic
1179505531 21:41837524-41837546 CAGGGGCTGGGGGAGGGGGCTGG + Intronic
1179973681 21:44850748-44850770 CGGTGTGGGGAGGACGGGGCAGG - Exonic
1180068623 21:45425067-45425089 CAGTCTCATGAGGACGGGGTGGG + Intronic
1180954015 22:19733402-19733424 CAGTGCGGGGAGGAGGGAGCTGG - Intergenic
1181116661 22:20635868-20635890 CAGTGGTGGGAAGAGGGGGCTGG + Intergenic
1181479116 22:23186554-23186576 CAGTGCCAGGGGCTGGGGGCAGG - Intronic
1181648700 22:24247311-24247333 CTGTGCCTGGAGGAGGGAGCAGG + Intergenic
1181683744 22:24514479-24514501 CAGGATCAGGAGGAGGTGGAAGG + Intronic
1181984368 22:26789391-26789413 CAGTGTCTGGAGGATGAGGGTGG - Intergenic
1182283889 22:29232792-29232814 CAGGGCCTGGAGGAGGGGCCGGG - Intronic
1182427910 22:30284543-30284565 CAGGGCCAGGAGGATGGGACAGG - Intergenic
1183066784 22:35368874-35368896 CAGTTACAGGAGGAGGTGGGAGG - Intergenic
1183546659 22:38457760-38457782 CAGGGAGAGGAGGAAGGGGCAGG + Intergenic
1183547227 22:38460921-38460943 GAGGGTAAGGAGGAGGTGGCAGG + Intergenic
1184048187 22:41985289-41985311 CTGTGAGAGGAGGAGGAGGCTGG - Intronic
1184098410 22:42329012-42329034 CAGAGTGAGGTGGAGGGTGCTGG - Intronic
1184417186 22:44359206-44359228 CAGAGCCAGGGGGAGGTGGCGGG + Intergenic
1184420772 22:44381758-44381780 CAGTGTGGGGAGGAAGGGGAAGG + Intergenic
1184533203 22:45070118-45070140 CAATGTGGGGAGGATGGGGCGGG + Intergenic
1184898412 22:47425963-47425985 CAGAGTCAGGTGGAGGGAGGTGG + Intergenic
1185116243 22:48939849-48939871 CAGACTCAGGGGGAGGCGGCCGG + Intergenic
1185156411 22:49195900-49195922 CAGTCTCGGGAGGAGTGAGCGGG - Intergenic
1185191376 22:49438623-49438645 CAGTGGAGGGAGGAGGGGGTTGG + Intronic
1185282997 22:49983643-49983665 CGGGGGCGGGAGGAGGGGGCGGG - Intergenic
1185337463 22:50276985-50277007 AAGTGTCAGGAGTTCGGGGCAGG - Intronic
1185427581 22:50781998-50782020 GTGTGTCAGGTGGAGGGGGCAGG - Intronic
949302894 3:2605343-2605365 CAGTGTTAGGAGGTGGGAGAAGG + Intronic
949863043 3:8523860-8523882 CTGTCTCAGGAGGAGAGGTCAGG + Intronic
950551699 3:13670009-13670031 CTCTGTCAGTAGGAAGGGGCAGG + Intergenic
950851585 3:16067277-16067299 CAGTGTTGGGAGGTGGGGCCTGG + Intergenic
950963827 3:17132196-17132218 CAGTGTCAGCAGGAAGCGGAGGG - Intergenic
951363308 3:21750649-21750671 CAGGGACATGTGGAGGGGGCGGG - Intronic
952258378 3:31714850-31714872 CAGTGTTAAGAGGAGGCGTCTGG - Intronic
953336405 3:42098087-42098109 CAGGGTGAGGAGGAGGGGAGGGG - Intronic
953815709 3:46154499-46154521 CAGTGTCAGCAAGAGAGAGCAGG - Intergenic
953860555 3:46540768-46540790 CAGGGCCACGAGAAGGGGGCAGG - Intronic
954380701 3:50217530-50217552 CCCTGTCATCAGGAGGGGGCAGG + Intronic
955348299 3:58176902-58176924 CAGTATCAGTAGGAGTGGGTGGG + Intergenic
957131666 3:76230693-76230715 CAGTGTGAGAAGGAGAGGGTTGG - Intronic
957720793 3:83995718-83995740 CAGTAGCAGGAGGAAGGGGCAGG + Intergenic
960628302 3:119702895-119702917 CAGGGTCAGGAGGAGAGTGGAGG - Intergenic
961200063 3:125038495-125038517 CAGTGGCAGTAGGGGTGGGCTGG - Intronic
961266577 3:125647807-125647829 TGGCGTCAGGAGGAGGGGGTGGG + Intergenic
961337062 3:126186928-126186950 CAGTTTCAGGTGGTGGCGGCTGG - Intronic
961432098 3:126890521-126890543 CAGAGTCAGGAGGAGAGGTTGGG + Intronic
961487603 3:127227640-127227662 CCCTGCCAGGTGGAGGGGGCAGG + Intergenic
961695039 3:128698575-128698597 CCGGGTCAGAAGGAGGCGGCCGG - Intergenic
962411336 3:135143949-135143971 CTGTGCCTGGAGGAGGAGGCAGG - Intronic
964527353 3:157629749-157629771 CAGGGTGTGGAGGAGGAGGCAGG + Intronic
964654794 3:159054480-159054502 CAGTGTCAGGGAGAGAGGGAGGG - Intronic
965476685 3:169164214-169164236 CACTGTCATGAGGATGGTGCAGG - Intronic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966148352 3:176838217-176838239 CAGTGGCAGGTGGAGGGGAATGG - Intergenic
967381434 3:188863516-188863538 CAGTGTCAGGAGGAGGGGGCTGG - Intronic
967836290 3:193966135-193966157 CAGAGGCAGAAGGAGGGAGCTGG - Intergenic
967874249 3:194256032-194256054 CAGTGTAAGGAGGAGTGTGAGGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968363104 3:198162805-198162827 CAGTGTTAGGAGGATCGGTCAGG + Intergenic
968568511 4:1327396-1327418 CAGCTGCAGGAGCAGGGGGCGGG + Intronic
968578150 4:1377439-1377461 CAGTGTGAGGAGGGAGGGGCTGG + Intronic
968651260 4:1761152-1761174 CAGTGACAGGAGATGGGGGCGGG - Intergenic
968663856 4:1810261-1810283 CACGCTGAGGAGGAGGGGGCTGG - Intergenic
968729854 4:2264575-2264597 CAATGGCAGGAGGAGAGGGAAGG + Intergenic
968844032 4:3029816-3029838 CAGTGGCAGGAGCATGGGGAAGG - Intronic
968900785 4:3430799-3430821 CAGTCTCAGGAAGTGGAGGCCGG + Exonic
968997604 4:3955534-3955556 CAGGGTCAGGAGGAGAGTGGTGG + Intergenic
969202657 4:5618134-5618156 CTGTGGCTGGAGGAGGGGGCAGG + Intronic
969550384 4:7862380-7862402 CAGGGGCAGGAGTTGGGGGCGGG + Intronic
969627009 4:8310794-8310816 CAGGGTCAAGAGGTGGGGGTGGG + Intergenic
969853107 4:9977557-9977579 AGGTGTCAGGAGCAGGGGGAGGG - Intronic
969938662 4:10708096-10708118 CAATGACAGGAGGAAGTGGCAGG + Intergenic
972351998 4:38244559-38244581 CAAGGGAAGGAGGAGGGGGCCGG - Intergenic
972391433 4:38617330-38617352 CAGTGTTTGGAGGTGGGGCCTGG + Intergenic
972458731 4:39279514-39279536 CTGAGGCAGGAGGAGGAGGCTGG - Intronic
973601276 4:52545250-52545272 CAGACTCAGGAGGAGGGGCTGGG - Intergenic
975668311 4:76755121-76755143 CAGTGTGGGGAGGAGGTGGAGGG - Exonic
976132830 4:81903382-81903404 GAGAGTGAGGAGGAGAGGGCTGG - Intronic
976145730 4:82041359-82041381 CAGTGTCCTGAGCAGTGGGCTGG - Intronic
976401832 4:84615578-84615600 CTGTGGCAGGGGGAGGGGGTGGG - Intronic
976633486 4:87263947-87263969 CAGTATCAGGAGGCAGAGGCAGG - Intergenic
977080843 4:92525617-92525639 CAGTGTCAGGAGGTAGAGGGAGG - Intronic
977937970 4:102827574-102827596 AAGAGGCAGGAGGAGGGGGAGGG - Intronic
978067594 4:104424737-104424759 CAGTGTCAGTGAGAGGGGGAGGG + Intergenic
978243894 4:106549209-106549231 CACTTTGAGGAGGAGGAGGCAGG - Intergenic
978370791 4:108027825-108027847 CAGTGTCTCTAGGAGGGGTCGGG + Intronic
979336500 4:119469253-119469275 CATTGGCAGGAGGAGGAGGTTGG - Intergenic
980325861 4:131344957-131344979 CAGTGTCAGGAGTAGAGGAGAGG + Intergenic
980990531 4:139735315-139735337 CAGTGTCAGTCGGAGGAGGGGGG - Intronic
981615371 4:146638996-146639018 CAGAGTCCGGAGGCGGCGGCGGG + Exonic
983239405 4:165214595-165214617 CATTGGCAGGAGGAGGAGGTTGG - Intronic
984804603 4:183739726-183739748 CTGTGTGAGGTGGCGGGGGCGGG - Intergenic
984992712 4:185396645-185396667 CGGGGGCAGGGGGAGGGGGCGGG - Exonic
985472254 5:53541-53563 CGGCGGCGGGAGGAGGGGGCGGG + Intergenic
985521952 5:377897-377919 CAGTGTCAGGAGCAGACGGGCGG - Intronic
985616096 5:922911-922933 CAGTGGGAGGCGGAGGGGCCAGG - Intergenic
985657006 5:1137526-1137548 CAGGTTGAGGAGGAGGGGGAAGG - Intergenic
985705747 5:1400527-1400549 CAGTGCCAGGAGGGGAGGCCTGG - Intronic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985793711 5:1946867-1946889 CAGTGTCTGGAGGGTGAGGCTGG - Intergenic
986118456 5:4804881-4804903 CACTGTCAGCTGGAGGGCGCAGG - Intergenic
986429193 5:7664979-7665001 CAAAGTGAGGAGGAGGGGGCGGG - Intronic
986476218 5:8136479-8136501 CAGTGACAGAAGGAAGGAGCAGG - Intergenic
986608819 5:9547008-9547030 CAGTTTCTGGAGGAGGCGGTGGG + Intergenic
986891980 5:12320384-12320406 CAGTGTGAGGAGGAAGTGGATGG + Intergenic
988526381 5:31990862-31990884 CAGTGTCATGGGCAGGGGGCTGG + Intronic
989972408 5:50541181-50541203 CAGTGTCAGAAAGTGGGTGCAGG + Intergenic
990687081 5:58316641-58316663 CATTGGCTGGAGTAGGGGGCAGG + Intergenic
990828873 5:59934093-59934115 CAGTGCCTGGAGGCTGGGGCAGG - Intronic
991569109 5:68035903-68035925 CACTGTCAGGCGGAGAGGGGAGG - Intergenic
993701926 5:91128684-91128706 GGGTGGCAGGGGGAGGGGGCAGG + Intronic
994087004 5:95770001-95770023 CAGTGTTTGGAGAAGGGGGTAGG + Intronic
995340990 5:111059373-111059395 CAGTTGCAGGAGGATGAGGCAGG - Intergenic
995590119 5:113690614-113690636 CAGTGACAGGAGGCTGAGGCAGG + Intergenic
996184925 5:120464047-120464069 CAGAACCAAGAGGAGGGGGCGGG + Intergenic
997626452 5:135334297-135334319 CAGTCCCAGGATGTGGGGGCAGG - Exonic
998143529 5:139712626-139712648 AGATGTGAGGAGGAGGGGGCAGG + Intergenic
998148484 5:139744062-139744084 CAGAGCCAGGAGGAGAAGGCAGG - Intergenic
998400247 5:141844938-141844960 CAGTGGCAGGAGGAGGGGATTGG + Intergenic
999319798 5:150606850-150606872 CAGGCTCAGGAGTTGGGGGCAGG - Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999690648 5:154143278-154143300 CAGTGTCAGGAGAAGGCTGTGGG - Intronic
1001036473 5:168300293-168300315 GGGTGGCGGGAGGAGGGGGCAGG + Intronic
1001484075 5:172107067-172107089 CAGAGTCCTGGGGAGGGGGCGGG + Intronic
1001565150 5:172695291-172695313 CATTGTCAGGAGGAGGGGGAGGG + Intergenic
1001990729 5:176113635-176113657 CAGGGTCCAGGGGAGGGGGCTGG + Intronic
1002167597 5:177358089-177358111 CAGGGCCACGAGGAGGGGGTGGG + Intronic
1002211838 5:177604139-177604161 CAGGGTCAGGAGGGCGGGGCAGG - Intronic
1002226144 5:177724505-177724527 CAGGGTCCAGGGGAGGGGGCTGG - Intronic
1002564018 5:180100029-180100051 CAGTGTGGAGAGGTGGGGGCAGG - Intergenic
1002898302 6:1391618-1391640 AAGTGTTAAGAGGAGGGGGTGGG + Intronic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1003197294 6:3926166-3926188 CAGTGCCAGGATCAGAGGGCCGG + Intergenic
1003318526 6:5032983-5033005 CAGTGCCAGGATCAGAGGGCCGG - Intergenic
1003414606 6:5896774-5896796 CAGGGTCGGGAGGAAGAGGCTGG + Intergenic
1003660451 6:8055916-8055938 CAGTGTTGGGAGGTGGGGTCTGG + Intronic
1004350874 6:14889287-14889309 CTGAGGCAGGAGGATGGGGCAGG - Intergenic
1004400962 6:15288290-15288312 CATGGTCAGGAGGTGGGGGTTGG + Intronic
1004523546 6:16384590-16384612 CAGTGTTTGGAGGAAGGGCCTGG + Intronic
1004935214 6:20500835-20500857 CAGTGTCAAGAGGCGGGGCGTGG + Intergenic
1005083570 6:21981238-21981260 CAGTGCCAGAAGGAAGAGGCAGG - Intergenic
1005339679 6:24831486-24831508 CATGATCATGAGGAGGGGGCTGG + Intronic
1005471179 6:26164166-26164188 CAGTGGTAGCAGGAGGTGGCAGG + Intronic
1005654429 6:27919534-27919556 CAGTATCAGGAGGAGAAGGAGGG + Intergenic
1005661953 6:28007397-28007419 CAGTCTCAGGAGGCTGAGGCAGG - Intergenic
1006360294 6:33583797-33583819 ACATGTGAGGAGGAGGGGGCCGG + Intergenic
1006362646 6:33595353-33595375 CAGTGGCAGGTGGAGTGGACAGG + Intergenic
1006423665 6:33950677-33950699 CAGGGCCAGGAGGAGGGGCTGGG + Intergenic
1006569600 6:34990701-34990723 CAGTGTCAAGAAGTGGTGGCTGG + Intronic
1006810947 6:36820165-36820187 CTGGGTCAGGATGAGGGGTCCGG - Intronic
1007171316 6:39865411-39865433 CCTTGTGAGGATGAGGGGGCAGG + Intronic
1007309814 6:40936423-40936445 AAGGGACAGGAGGAGGTGGCTGG - Intergenic
1007630761 6:43272060-43272082 CAGTGCCAGCAGGAGGGGAGTGG - Intronic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1008523069 6:52381037-52381059 CAGTGGGAGGAGGAGGGTGGGGG - Intronic
1008572926 6:52832398-52832420 CAGTGTCAGGGGCAGAGTGCTGG + Intronic
1008921545 6:56848553-56848575 CAGTGTGAGGATGAGGGTACAGG - Intronic
1009843362 6:69105453-69105475 CACTGACAGTAGGAGAGGGCAGG - Intronic
1011982789 6:93404019-93404041 CAGTATCAGGCAGAGGGAGCAGG + Intronic
1012251597 6:96986878-96986900 GAGTGTCAGGAAGTGGGTGCAGG - Intronic
1014558231 6:122859193-122859215 CAGTGTCAGCAGCAAGGGGGAGG - Intergenic
1015054142 6:128878913-128878935 CAGTGTTTGGAGGTGGGGACAGG + Intergenic
1015588015 6:134795940-134795962 GTATGTCAGGAGGAGGAGGCTGG - Intergenic
1015956854 6:138607885-138607907 AAGTGACAGAAGGAGGGAGCAGG + Intronic
1016068080 6:139704571-139704593 CAGTGTTGGGAGGTGGGGCCTGG + Intergenic
1016452148 6:144194472-144194494 CAGTGTCCTGAGAAGGGGGGTGG + Intergenic
1016506860 6:144791680-144791702 CAGTGTCAGGGTAAAGGGGCAGG - Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016993962 6:149947906-149947928 TAATCCCAGGAGGAGGGGGCTGG + Intronic
1017004371 6:150019631-150019653 TAATCCCAGGAGGAGGGGGCTGG - Intronic
1017896773 6:158686862-158686884 CAGGGCCAGGAGGAGGGAGAAGG - Intronic
1018056416 6:160055982-160056004 CAGTGGCAGGAAGAGGGCACAGG - Intronic
1018759829 6:166884310-166884332 CAGGGTATGGAGGAAGGGGCAGG - Intronic
1018998789 6:168729863-168729885 CAGAGTCAGGAAGAAGGGGCTGG - Intergenic
1019050234 6:169176978-169177000 GAGGGCCAGGAGGAGGGTGCTGG + Intergenic
1019252577 7:25907-25929 CAGTGTTAGGAGGATTGGTCAGG - Intergenic
1019325013 7:433728-433750 CACTTCCAGGAGGAGGCGGCTGG - Intergenic
1019333665 7:472466-472488 AAGTGTCAGGATGAGGGGGCCGG - Intergenic
1019423360 7:962129-962151 CACTGTGGGGAGGAGGGGTCAGG - Intronic
1019720445 7:2567440-2567462 AAGTGTCAGGATGAGGGCGTGGG - Intronic
1019746286 7:2701992-2702014 CCGGGTCAGGAGGTGGGGACTGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1021446293 7:20737044-20737066 CAGCTTCAGGAGGTGGAGGCAGG + Intronic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1021798726 7:24284061-24284083 GAGTGGCGGGGGGAGGGGGCTGG - Intergenic
1022010683 7:26305497-26305519 CACTGTCTGGATTAGGGGGCAGG + Intronic
1022103377 7:27182344-27182366 CAGGGGCAGGAGGAAGGGGTAGG - Exonic
1023792389 7:43763208-43763230 CAGAGCTGGGAGGAGGGGGCTGG + Intronic
1023965888 7:44962896-44962918 CTGCGGCAGGAGGAGGGGTCAGG + Intronic
1024041454 7:45559215-45559237 CAGTTTCAGCAGGAGAGGGTTGG - Intergenic
1024224134 7:47312731-47312753 AAATGTCAGGGGGAGGGGGGAGG + Intronic
1024280867 7:47718478-47718500 CATTGCCAGGAGGTGGGGGTAGG + Intronic
1024444941 7:49466146-49466168 CAGTGTTAGGAGCAGAGGGAAGG + Intergenic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1026463745 7:70636173-70636195 CTGTGTCACGAGGAGTGGCCCGG + Intronic
1026942228 7:74293773-74293795 CAGTGTGGGGAGGAGAGGACAGG + Intronic
1026959480 7:74399239-74399261 CAGTGTAAGAAGAAGGGTGCTGG + Intronic
1029483524 7:100826418-100826440 CAGGGGCAGGAGCAGTGGGCGGG + Intronic
1031045077 7:116878654-116878676 CAGGGTCAAGTGGAGGGGGAAGG + Intronic
1031837537 7:126696381-126696403 GCCTGTCAGGAGTAGGGGGCAGG - Intronic
1031976990 7:128100427-128100449 AGGTGTCAGGAGGTGGGGGGTGG + Intergenic
1032073024 7:128821370-128821392 CAGAGTCAAGAGGATGGGGAAGG - Intronic
1032201307 7:129825117-129825139 CAGGGGCAGGAGGAAGGGACCGG - Intergenic
1032370658 7:131347539-131347561 CTGTGTCAGTAAGAGGGGGCAGG - Intronic
1033565522 7:142574899-142574921 CAGAGGCAGGGGGAGGGGGAGGG - Intergenic
1033569743 7:142616155-142616177 CCTGGTCAGGAGGAGGGGACAGG + Intergenic
1033608940 7:142947167-142947189 CAGGGACAGGAGGAGGTAGCTGG + Intronic
1034277767 7:149831095-149831117 GAGTGGCAGGAGGTGGGGGTGGG - Intergenic
1034421297 7:150992458-150992480 CTGTCTCAGGAGGAGGGAGATGG - Intronic
1034835495 7:154348085-154348107 CAGCATCAGGAGGTGGGGGTGGG - Intronic
1034946585 7:155266434-155266456 CAGTGACAGGAGGGGAAGGCAGG - Intergenic
1035162513 7:156961374-156961396 CAGTCTGAAGAGGAGGGGGCTGG + Intronic
1035475254 7:159139263-159139285 CAGTGTCAAAAGGAGGCTGCTGG - Intronic
1035753515 8:2012305-2012327 CAGTGACAGGAGGAGAGGGAAGG + Intergenic
1036104308 8:5823946-5823968 TAGTGTCAGGAGACGGAGGCTGG + Intergenic
1036379656 8:8228468-8228490 CAGGGTCAGGAGGAGCGTCCTGG - Intergenic
1036410150 8:8492397-8492419 CAGTGTCAGGAGGAGGACAGAGG + Intergenic
1036707005 8:11053566-11053588 CAGAGTCAGGAAGTGGGTGCAGG - Intronic
1036748655 8:11429121-11429143 CAGGGGCTGGAGGAGGGGGATGG - Intronic
1037018890 8:13943447-13943469 CAGTGTGAGGAGGATGTGGGAGG - Intergenic
1037147638 8:15592529-15592551 GAGAGTTAGGAGGAGGTGGCAGG - Intronic
1037272367 8:17144062-17144084 CAGTGTCAGGCTGAGGGAGGTGG + Intergenic
1037503385 8:19506581-19506603 CAGTGTTGGGAGGTGGGGCCTGG + Intronic
1037560980 8:20074116-20074138 CAGAGTCAGGAGGTGGGGCGTGG + Intergenic
1037587479 8:20288040-20288062 GAGAGGCAGGAGGTGGGGGCTGG - Intronic
1037833934 8:22205198-22205220 CAGTGGCTTGAGGAGGGGGCTGG + Intronic
1038395828 8:27244736-27244758 AAGTGGAAAGAGGAGGGGGCGGG + Intronic
1039664951 8:39515810-39515832 CAATGTGAGGAGGAGAGTGCAGG - Intergenic
1040369799 8:46758113-46758135 GAGTGTCAGGAAGTGGGTGCAGG - Intergenic
1040552703 8:48450748-48450770 CTGTGTCTGGATGAGGGGGAAGG + Intergenic
1040552740 8:48450920-48450942 CTCTGTCAGCAGGTGGGGGCTGG + Intergenic
1040591128 8:48793005-48793027 CTGTGTCAGTAGGAGAGGTCAGG - Intergenic
1040819271 8:51537198-51537220 GAATCTCAGGAGGAGGGTGCTGG - Intronic
1040877263 8:52166595-52166617 CAGTGTCCAGAGGAAGGGCCAGG - Intronic
1042154054 8:65822204-65822226 CAAGGTCAGAATGAGGGGGCAGG - Intronic
1043951898 8:86318694-86318716 AAGTGTTATGAGGAGGGGCCTGG + Intronic
1045555047 8:103207646-103207668 AAATGGCAGGGGGAGGGGGCAGG + Intronic
1047167917 8:122461311-122461333 CTGAGTAAGAAGGAGGGGGCTGG + Intergenic
1047682449 8:127268037-127268059 CAGTGCCAGGCTGAGGGGGGTGG - Intergenic
1048312077 8:133331651-133331673 CAGACTCAGGAGGAGGGTGGGGG - Intergenic
1048395610 8:134011303-134011325 CACAGTCAGGTGCAGGGGGCGGG + Intergenic
1048513174 8:135080621-135080643 CAGTGTCAGCAGAAGGGGTGGGG - Intergenic
1049219215 8:141421258-141421280 CATGGTCAGGAGGAGGGCTCTGG + Intronic
1049221701 8:141431543-141431565 CAGCGTCAGGCGGGGCGGGCTGG + Exonic
1049254572 8:141606766-141606788 CAGTCTCAGGAGGCCAGGGCAGG - Intergenic
1049255016 8:141609138-141609160 CAGTGGCAGGGGGTGGGGGCTGG + Intergenic
1049365616 8:142235411-142235433 GGGGGTCAGGAGGAAGGGGCCGG - Intronic
1049676470 8:143891476-143891498 CAGTGGCTGGAGGAGGGGCCCGG - Intergenic
1049681004 8:143918190-143918212 CAGTGGCAGGAGCAGCTGGCCGG + Exonic
1049750317 8:144280006-144280028 CAGTGTCATGCTGAGGGGCCGGG - Intronic
1051626253 9:19102505-19102527 GAGTGTAAGGAGGCCGGGGCCGG - Exonic
1052210968 9:25902832-25902854 CAGTGTCAGGAGGATTGGCATGG - Intergenic
1052348023 9:27429609-27429631 TAGTGGCAGGAGGAGGAAGCTGG + Intronic
1052933904 9:34077466-34077488 CTGTGGCAGGAGGCTGGGGCAGG + Intergenic
1052963469 9:34320012-34320034 TAGTGTCAGGAGAAGAGGGCTGG - Intronic
1053114393 9:35489178-35489200 CACTGTCACGAGAAGGGCGCAGG - Intergenic
1053130191 9:35610145-35610167 CAGTTTCAGGAAGAGGGAGCAGG + Exonic
1053454960 9:38226893-38226915 CAGAGTAAGGGGGCGGGGGCTGG + Intergenic
1053522519 9:38794657-38794679 CAGAGACAGGAGGAGAGGACAGG - Intergenic
1053705429 9:40748406-40748428 TAGTGTCAGGAGAAGGAAGCTGG + Intergenic
1053740208 9:41128709-41128731 GGGTGCGAGGAGGAGGGGGCTGG - Intergenic
1053900737 9:42793094-42793116 CGGTGGCCGGAGGAGGGGGGAGG + Intergenic
1054194747 9:62019079-62019101 CAGAGACAGGAGGAGAGGACAGG - Intergenic
1054415504 9:64872013-64872035 TAGTGTCAGGAGAAGGAAGCTGG + Intergenic
1054643661 9:67569611-67569633 CAGAGACAGGAGGAGAGGACAGG + Intergenic
1054688140 9:68302604-68302626 GGGTGCGAGGAGGAGGGGGCTGG + Intergenic
1054800658 9:69345154-69345176 AAGTGTCAGGTGAAGGAGGCTGG + Intronic
1055574708 9:77648930-77648952 CGGTCTCCGGACGAGGGGGCTGG + Intergenic
1055767108 9:79675290-79675312 GAGGGTCAGGAGGAGATGGCAGG - Intronic
1055767223 9:79676505-79676527 GAGGGTCAGGAGGAGATGGCAGG + Intronic
1056223036 9:84468547-84468569 CAGTGTCAGGCAGTGGGGGAAGG + Intergenic
1056754341 9:89372727-89372749 CAGTGACAAGAGGGGTGGGCAGG - Intronic
1057034708 9:91803389-91803411 CAGAGGCTGGAGGAGGGGACAGG + Intronic
1057187084 9:93062995-93063017 CAGTGCCAAGAGTAGGAGGCTGG - Intronic
1057230519 9:93318844-93318866 CAGTGGGAGGTGGAGGAGGCTGG - Intronic
1057600209 9:96450695-96450717 CGGTTTCAGGAGGAGGGGCCCGG + Intronic
1057854671 9:98593428-98593450 CAATGGCAGGAGCAGGGGGAAGG + Intronic
1058125033 9:101182228-101182250 CAGTGGCTGGAAGAGGGGGATGG + Intronic
1058709630 9:107668000-107668022 CAGTGTGAGGCGGAGGCCGCGGG - Intergenic
1059433644 9:114264224-114264246 AAGTGGGAGGAGGAGGGGGCCGG + Intronic
1060485251 9:124042343-124042365 CAGGGCCAGGAGGGGGAGGCAGG - Intergenic
1060552830 9:124493685-124493707 CAGGCTCAGGAGGAGGAGGGAGG + Intronic
1061011192 9:127955591-127955613 CATTGTCACCAGGAGAGGGCGGG + Intronic
1061222032 9:129257890-129257912 CAGTGCCAAGAGCTGGGGGCAGG - Intergenic
1061396337 9:130345864-130345886 CAGGGTAGGGCGGAGGGGGCAGG + Intronic
1061423198 9:130483422-130483444 CAGGGTCAGGGACAGGGGGCTGG + Intronic
1061550073 9:131329250-131329272 CCGGGTCAGGTGGAGGGAGCAGG + Intergenic
1061619663 9:131803647-131803669 CAGAGGTAGGAGGAGGGAGCAGG + Intergenic
1062152708 9:135030164-135030186 CCACATCAGGAGGAGGGGGCAGG - Intergenic
1062233868 9:135498857-135498879 CAGTGGCAAGCAGAGGGGGCCGG - Intronic
1062254244 9:135613643-135613665 CAGGGGCAGGAGGATGGGGCAGG + Intergenic
1062473617 9:136717340-136717362 CAGGGGCCGGAGGTGGGGGCAGG - Intronic
1062504359 9:136865765-136865787 CAGAGGCAGGAGGTGGGGACGGG - Intronic
1062582066 9:137233166-137233188 CAGGGTCAGGTGGGGGGGCCCGG - Intronic
1062590335 9:137271799-137271821 CAGGGACAGGAGGAGGGTGGAGG - Intronic
1062747791 9:138226467-138226489 CAGTGTTAGGAGGATTGGTCAGG + Intergenic
1203518585 Un_GL000213v1:26086-26108 CGGTGTCCGGGGAAGGGGGCGGG + Intergenic
1185445326 X:254869-254891 CAGGGTCAGGAGGAACGGCCAGG + Intergenic
1187904749 X:24055117-24055139 CAGTGTCGGGAGCATGGGTCAGG + Intronic
1188716563 X:33465526-33465548 CAGTGTCAGGGGCTGGGGGAAGG + Intergenic
1189237373 X:39497657-39497679 AAGGGTCAGGAGGAGAGGGCTGG + Intergenic
1190598531 X:52068222-52068244 CAGCTGCAGGGGGAGGGGGCGGG + Exonic
1190610293 X:52185851-52185873 CAGCTGCAGGGGGAGGGGGCGGG - Exonic
1191846213 X:65549977-65549999 CAGACACAGGAGGAGAGGGCAGG + Intergenic
1192207288 X:69105000-69105022 GAGAGGCAGGGGGAGGGGGCCGG + Intergenic
1192216467 X:69162844-69162866 GATAGTGAGGAGGAGGGGGCTGG - Exonic
1194318464 X:92411921-92411943 GAGTGGGAGGAGGAGGGGGGAGG + Intronic
1194823290 X:98531489-98531511 CAGTGCCAGGAGTAGGGGAGGGG - Intergenic
1195169520 X:102252278-102252300 CAGTGGCCGGGGGAGGGGGGTGG - Intergenic
1195189337 X:102434821-102434843 CAGTGGCCGGGGGAGGGGGGTGG + Intronic
1195703816 X:107724225-107724247 CAGTGGCAGGAGGAGGCAGGGGG + Intronic
1196001455 X:110791433-110791455 GAGTGGCAGGAAGTGGGGGCGGG - Intronic
1196060407 X:111402296-111402318 CAGAGGCAAGAGGAGGGGACTGG + Intronic
1196862444 X:120040829-120040851 CAGGGGCAGGAGGAGGTGACAGG + Intergenic
1196880658 X:120195515-120195537 CAGGGGCAGGAGGAGGTGACAGG - Intergenic
1197854716 X:130902754-130902776 CAGAGCCAGGGGGAGGGGGGCGG + Intronic
1198367079 X:135951666-135951688 CAGAGTCAGGAGGAGATGGATGG + Intergenic
1199665824 X:150095659-150095681 CAGAGTCAGGAGGAGGATGGTGG - Intergenic
1199853566 X:151741845-151741867 CAGTGGGAAGGGGAGGGGGCTGG + Intronic
1199951107 X:152706771-152706793 CAGTGTCTGGGGTAGGGGGCTGG + Intergenic
1199958577 X:152761690-152761712 CAGTGTCTGGGGTAGGGGGCTGG - Intergenic
1200108869 X:153728921-153728943 CCGAGCCAGGAGGAGGGGGCTGG + Intronic
1200626637 Y:5525226-5525248 GAGTGGGAGGAGGAGGGGGTAGG + Intronic