ID: 967385702 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:188908768-188908790 |
| Sequence | TGGGACTCCTATGGAGAAAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 967385695_967385702 | -1 | Left | 967385695 | 3:188908746-188908768 | CCCTGACTGGTCCTTGCTCATTT | No data | ||
| Right | 967385702 | 3:188908768-188908790 | TGGGACTCCTATGGAGAAAAGGG | No data | ||||
| 967385696_967385702 | -2 | Left | 967385696 | 3:188908747-188908769 | CCTGACTGGTCCTTGCTCATTTG | No data | ||
| Right | 967385702 | 3:188908768-188908790 | TGGGACTCCTATGGAGAAAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 967385702 | Original CRISPR | TGGGACTCCTATGGAGAAAA GGG | Intergenic | ||
| No off target data available for this crispr | |||||