ID: 967385702

View in Genome Browser
Species Human (GRCh38)
Location 3:188908768-188908790
Sequence TGGGACTCCTATGGAGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967385695_967385702 -1 Left 967385695 3:188908746-188908768 CCCTGACTGGTCCTTGCTCATTT No data
Right 967385702 3:188908768-188908790 TGGGACTCCTATGGAGAAAAGGG No data
967385696_967385702 -2 Left 967385696 3:188908747-188908769 CCTGACTGGTCCTTGCTCATTTG No data
Right 967385702 3:188908768-188908790 TGGGACTCCTATGGAGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967385702 Original CRISPR TGGGACTCCTATGGAGAAAA GGG Intergenic
No off target data available for this crispr