ID: 967388795

View in Genome Browser
Species Human (GRCh38)
Location 3:188935126-188935148
Sequence AAGGGTCCTCCGCACTCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967388795_967388796 -8 Left 967388795 3:188935126-188935148 CCAGACGAGTGCGGAGGACCCTT No data
Right 967388796 3:188935141-188935163 GGACCCTTGAGAAACAGATGAGG No data
967388795_967388801 29 Left 967388795 3:188935126-188935148 CCAGACGAGTGCGGAGGACCCTT No data
Right 967388801 3:188935178-188935200 GTAGACAAAAGTGCCTTTGGAGG No data
967388795_967388799 -3 Left 967388795 3:188935126-188935148 CCAGACGAGTGCGGAGGACCCTT No data
Right 967388799 3:188935146-188935168 CTTGAGAAACAGATGAGGTTTGG No data
967388795_967388800 26 Left 967388795 3:188935126-188935148 CCAGACGAGTGCGGAGGACCCTT No data
Right 967388800 3:188935175-188935197 TCTGTAGACAAAAGTGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967388795 Original CRISPR AAGGGTCCTCCGCACTCGTC TGG (reversed) Intergenic
No off target data available for this crispr