ID: 967388797

View in Genome Browser
Species Human (GRCh38)
Location 3:188935144-188935166
Sequence AAACCTCATCTGTTTCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967388797_967388801 11 Left 967388797 3:188935144-188935166 CCCTTGAGAAACAGATGAGGTTT No data
Right 967388801 3:188935178-188935200 GTAGACAAAAGTGCCTTTGGAGG No data
967388797_967388800 8 Left 967388797 3:188935144-188935166 CCCTTGAGAAACAGATGAGGTTT No data
Right 967388800 3:188935175-188935197 TCTGTAGACAAAAGTGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967388797 Original CRISPR AAACCTCATCTGTTTCTCAA GGG (reversed) Intergenic
No off target data available for this crispr