ID: 967388798

View in Genome Browser
Species Human (GRCh38)
Location 3:188935145-188935167
Sequence CAAACCTCATCTGTTTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967388798_967388800 7 Left 967388798 3:188935145-188935167 CCTTGAGAAACAGATGAGGTTTG No data
Right 967388800 3:188935175-188935197 TCTGTAGACAAAAGTGCCTTTGG No data
967388798_967388801 10 Left 967388798 3:188935145-188935167 CCTTGAGAAACAGATGAGGTTTG No data
Right 967388801 3:188935178-188935200 GTAGACAAAAGTGCCTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967388798 Original CRISPR CAAACCTCATCTGTTTCTCA AGG (reversed) Intergenic
No off target data available for this crispr