ID: 967388800

View in Genome Browser
Species Human (GRCh38)
Location 3:188935175-188935197
Sequence TCTGTAGACAAAAGTGCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967388795_967388800 26 Left 967388795 3:188935126-188935148 CCAGACGAGTGCGGAGGACCCTT No data
Right 967388800 3:188935175-188935197 TCTGTAGACAAAAGTGCCTTTGG No data
967388797_967388800 8 Left 967388797 3:188935144-188935166 CCCTTGAGAAACAGATGAGGTTT No data
Right 967388800 3:188935175-188935197 TCTGTAGACAAAAGTGCCTTTGG No data
967388798_967388800 7 Left 967388798 3:188935145-188935167 CCTTGAGAAACAGATGAGGTTTG No data
Right 967388800 3:188935175-188935197 TCTGTAGACAAAAGTGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967388800 Original CRISPR TCTGTAGACAAAAGTGCCTT TGG Intergenic
No off target data available for this crispr