ID: 967388915

View in Genome Browser
Species Human (GRCh38)
Location 3:188936524-188936546
Sequence GATCTCAGTGGGCCACTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967388915_967388919 -10 Left 967388915 3:188936524-188936546 CCAGAAAGTGGCCCACTGAGATC No data
Right 967388919 3:188936537-188936559 CACTGAGATCCAGGATGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967388915 Original CRISPR GATCTCAGTGGGCCACTTTC TGG (reversed) Intergenic
No off target data available for this crispr