ID: 967389691

View in Genome Browser
Species Human (GRCh38)
Location 3:188943372-188943394
Sequence TCCCCGGATGTGTCCTCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967389691_967389694 -2 Left 967389691 3:188943372-188943394 CCGAGAGAGGACACATCCGGGGA No data
Right 967389694 3:188943393-188943415 GAAAGCTGAGACAGTGCTGGTGG No data
967389691_967389693 -5 Left 967389691 3:188943372-188943394 CCGAGAGAGGACACATCCGGGGA No data
Right 967389693 3:188943390-188943412 GGGGAAAGCTGAGACAGTGCTGG No data
967389691_967389695 16 Left 967389691 3:188943372-188943394 CCGAGAGAGGACACATCCGGGGA No data
Right 967389695 3:188943411-188943433 GGTGGAGATTGATGAGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967389691 Original CRISPR TCCCCGGATGTGTCCTCTCT CGG (reversed) Intergenic
No off target data available for this crispr