ID: 967391056

View in Genome Browser
Species Human (GRCh38)
Location 3:188954789-188954811
Sequence AAGAGCGCCCTCTGCTGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 97}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967391044_967391056 14 Left 967391044 3:188954752-188954774 CCTCCCAGTTTCCCACTGCCATC 0: 1
1: 0
2: 2
3: 31
4: 325
Right 967391056 3:188954789-188954811 AAGAGCGCCCTCTGCTGGAATGG 0: 1
1: 0
2: 2
3: 9
4: 97
967391052_967391056 -10 Left 967391052 3:188954776-188954798 CCAATCCTGCTCCAAGAGCGCCC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 967391056 3:188954789-188954811 AAGAGCGCCCTCTGCTGGAATGG 0: 1
1: 0
2: 2
3: 9
4: 97
967391051_967391056 -9 Left 967391051 3:188954775-188954797 CCCAATCCTGCTCCAAGAGCGCC 0: 1
1: 0
2: 1
3: 6
4: 105
Right 967391056 3:188954789-188954811 AAGAGCGCCCTCTGCTGGAATGG 0: 1
1: 0
2: 2
3: 9
4: 97
967391046_967391056 10 Left 967391046 3:188954756-188954778 CCAGTTTCCCACTGCCATCCCCA 0: 1
1: 0
2: 5
3: 61
4: 511
Right 967391056 3:188954789-188954811 AAGAGCGCCCTCTGCTGGAATGG 0: 1
1: 0
2: 2
3: 9
4: 97
967391049_967391056 -4 Left 967391049 3:188954770-188954792 CCATCCCCAATCCTGCTCCAAGA 0: 1
1: 0
2: 2
3: 43
4: 379
Right 967391056 3:188954789-188954811 AAGAGCGCCCTCTGCTGGAATGG 0: 1
1: 0
2: 2
3: 9
4: 97
967391048_967391056 2 Left 967391048 3:188954764-188954786 CCACTGCCATCCCCAATCCTGCT 0: 1
1: 1
2: 4
3: 64
4: 641
Right 967391056 3:188954789-188954811 AAGAGCGCCCTCTGCTGGAATGG 0: 1
1: 0
2: 2
3: 9
4: 97
967391045_967391056 11 Left 967391045 3:188954755-188954777 CCCAGTTTCCCACTGCCATCCCC 0: 1
1: 0
2: 3
3: 35
4: 400
Right 967391056 3:188954789-188954811 AAGAGCGCCCTCTGCTGGAATGG 0: 1
1: 0
2: 2
3: 9
4: 97
967391047_967391056 3 Left 967391047 3:188954763-188954785 CCCACTGCCATCCCCAATCCTGC 0: 1
1: 0
2: 3
3: 35
4: 362
Right 967391056 3:188954789-188954811 AAGAGCGCCCTCTGCTGGAATGG 0: 1
1: 0
2: 2
3: 9
4: 97
967391050_967391056 -8 Left 967391050 3:188954774-188954796 CCCCAATCCTGCTCCAAGAGCGC 0: 1
1: 0
2: 1
3: 6
4: 106
Right 967391056 3:188954789-188954811 AAGAGCGCCCTCTGCTGGAATGG 0: 1
1: 0
2: 2
3: 9
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967391056 Original CRISPR AAGAGCGCCCTCTGCTGGAA TGG Intronic