ID: 967392588

View in Genome Browser
Species Human (GRCh38)
Location 3:188971844-188971866
Sequence TTGAAGTTAGATATGCTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967392586_967392588 28 Left 967392586 3:188971793-188971815 CCATGTACTGAAATGGGCATGCA 0: 1
1: 0
2: 0
3: 10
4: 151
Right 967392588 3:188971844-188971866 TTGAAGTTAGATATGCTGATTGG 0: 1
1: 0
2: 0
3: 7
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967392588 Original CRISPR TTGAAGTTAGATATGCTGAT TGG Intronic
900200861 1:1405650-1405672 CTGTAGTTTGCTATGCTGATGGG - Intronic
901702601 1:11053647-11053669 CTGAGGTCAGATCTGCTGATGGG + Intergenic
908434599 1:64092709-64092731 TTGAAGTCAGGTATGCTGGAAGG - Intronic
915593203 1:156882143-156882165 TGGAAGTTAGATGTACTGGTAGG + Intergenic
916201547 1:162276309-162276331 TTGGAGTTACCTATGGTGATGGG + Intronic
916235716 1:162585864-162585886 ATGAAGTAAGAGATGGTGATGGG + Intronic
916832455 1:168506962-168506984 TTGTTGTTAAATATGCTAATTGG + Intergenic
918829151 1:189369485-189369507 TTGAAGTTAAATAGGCTTTTGGG + Intergenic
923471347 1:234293672-234293694 TTGAAGGCAGATGTGCTGTTTGG - Intronic
924237749 1:242013372-242013394 TTGATGTAAGAGATGCTGTTGGG - Intergenic
1065538683 10:26739559-26739581 GTGTGGTAAGATATGCTGATTGG - Intronic
1068336225 10:55635364-55635386 TTGAAGTGAGCTAGGCCGATTGG + Intergenic
1068477008 10:57539740-57539762 TTAAAGTTAGATGTAATGATGGG + Intergenic
1070421527 10:76242215-76242237 CTGTAGTGAGCTATGCTGATTGG - Intronic
1073602206 10:104857686-104857708 TTGGGGTTAGATGTGCTGACTGG + Intronic
1074175374 10:110995541-110995563 TTGAAGGCAGATTTGTTGATAGG + Intronic
1075134191 10:119768325-119768347 CTGGAGTGAGCTATGCTGATTGG + Intronic
1079818790 11:25097122-25097144 CTGAAGTTGGAAATGCAGATAGG + Intergenic
1080285933 11:30611662-30611684 TTGAAGTTACATATTATGTTAGG + Intergenic
1080984988 11:37452128-37452150 GTGGAGTTAGAATTGCTGATTGG + Intergenic
1085960354 11:81454604-81454626 TTCAGGCTAGATATGCTCATGGG + Intergenic
1087522648 11:99261716-99261738 TTGAAGATAGGTAAGGTGATAGG + Intronic
1087551441 11:99655431-99655453 TAAAAGTTAGATATGCAGACTGG + Intronic
1088359697 11:108977536-108977558 TTGAAGATAGACTTGCAGATAGG - Intergenic
1095542401 12:43325794-43325816 TTGAAGTTACATATTCTTAAAGG + Intergenic
1096973259 12:55684111-55684133 TGGAAGATAGATAGGCTGGTGGG - Exonic
1097930755 12:65182687-65182709 TAAAAGGTAGATTTGCTGATAGG + Intronic
1098420441 12:70291200-70291222 TTAAAGTAAGAAATGCTTATTGG - Intronic
1098754795 12:74347767-74347789 TTGAAGGTAGATAACATGATAGG + Intergenic
1099634047 12:85190609-85190631 GTACAGTTAGATATTCTGATGGG + Intronic
1099674110 12:85734939-85734961 TTGAAGTTATATATTTTGTTAGG - Intergenic
1100635247 12:96429265-96429287 TTCAAGATAAAAATGCTGATTGG - Intergenic
1102172342 12:110851925-110851947 TTGAAATGAGATCTGATGATTGG + Intronic
1103602119 12:122060929-122060951 TTGAAGTTAGCAATGCCGAAAGG + Exonic
1105887090 13:24651407-24651429 TAGGATTTAGATATGCTGATGGG - Intergenic
1107348289 13:39486751-39486773 TTGACATTAGATATCCTGATAGG - Intronic
1109168682 13:59068445-59068467 TTGAAGTTATATATTCTCAATGG - Intergenic
1111549817 13:89792272-89792294 TTGAAATTGGATATGCTTCTGGG + Intergenic
1112027481 13:95424750-95424772 TAGAAGTTAGATATTCTGGATGG + Intergenic
1112425098 13:99290920-99290942 TTGAATTCAGATGTGGTGATGGG + Intronic
1113010991 13:105765388-105765410 TTGAAGCTAGACATGTTGGTGGG - Intergenic
1114896159 14:26993728-26993750 TGGAAGTTAGAACTGCTGACTGG - Intergenic
1115123848 14:29970144-29970166 TTGAATTTAGAAATTCTGAAGGG - Intronic
1117194506 14:53326364-53326386 TTGAAGGTAGAAATGCTGAATGG - Intergenic
1120317582 14:82915736-82915758 TTGAAGTTAGATAGCCTGGTGGG - Intergenic
1121108304 14:91295156-91295178 TTAAAGTTAGAATTGCTTATGGG - Intronic
1121414700 14:93771361-93771383 TTGAAGGTTGAGAGGCTGATGGG - Intronic
1125662913 15:41408241-41408263 GAGAGGTGAGATATGCTGATTGG - Intergenic
1128480588 15:68034383-68034405 TTGAAGTTAGACATACCCATTGG - Intergenic
1129633837 15:77292956-77292978 TTTAAGTTTGAAGTGCTGATAGG - Intronic
1131736319 15:95336199-95336221 TTGTAGTTAGTTCTGCTCATAGG - Intergenic
1132780281 16:1620577-1620599 TTGATGTTAGAGATGATGACAGG + Intronic
1134874355 16:17683789-17683811 TTGCAGTGAGATGTGCTGATTGG - Intergenic
1138299990 16:55918071-55918093 TCATAGTCAGATATGCTGATGGG + Intronic
1143042148 17:4046559-4046581 TTGAGGTTACATATGCAGAGGGG - Intronic
1144245901 17:13364303-13364325 TTCAAGTTAGATTTCCTGTTGGG + Intergenic
1145820257 17:27827658-27827680 TGGAACTTAGATATGCAGAAGGG - Intronic
1145825637 17:27875344-27875366 CTGAAGTTCGAGATGCTGAGAGG - Intronic
1147225288 17:38971756-38971778 TTGAAGAAATATTTGCTGATGGG + Intergenic
1150110466 17:62494774-62494796 CTGAGGATGGATATGCTGATGGG + Intronic
1155195645 18:23471607-23471629 TTGAAGTGAGAAATGGTGAAGGG + Intronic
1155781001 18:29835934-29835956 TTAAAGTTAGATAAACTTATGGG - Intergenic
1157747120 18:50145571-50145593 TTTAAATTAAAAATGCTGATGGG + Intronic
1158616473 18:58992352-58992374 GTGAGGTTAGATATGGTGACGGG - Intergenic
1161919452 19:7255200-7255222 ATCAGGTTAGATAAGCTGATGGG - Intronic
925234759 2:2267955-2267977 TTGAAGTTAGACATGCAAAGCGG - Intronic
925536560 2:4924619-4924641 TTGAAGAAAGATATTCAGATGGG + Intergenic
926857201 2:17270102-17270124 TTGAAGTCAGAAATACCGATAGG + Intergenic
930759039 2:55011796-55011818 TTGGAGTTAGAGAGGCAGATAGG - Intronic
930875064 2:56205984-56206006 TTGAATTTAGATAGGCTGGCAGG + Intronic
933343761 2:81056008-81056030 TTGAAATTTGGTATGCAGATTGG + Intergenic
933525937 2:83438809-83438831 TTGAAGTTAAAGATACTGATAGG - Intergenic
934085546 2:88506194-88506216 AGGAAGTAAGATATCCTGATTGG + Intergenic
935441389 2:103101196-103101218 TTTATGTTAGCTATTCTGATAGG - Intergenic
935441420 2:103101856-103101878 TTTATGTTAGCTATTCTGATAGG - Intergenic
936255785 2:110909658-110909680 TTGAAATTTAACATGCTGATGGG + Intronic
937606293 2:123805432-123805454 TTGAAGTTAAAAATTCTAATTGG - Intergenic
937725168 2:125155812-125155834 TTGAAGTTAAATATCATTATTGG - Intergenic
941019106 2:160389153-160389175 GTGAAGTTAGGTATACTTATCGG - Intronic
941705319 2:168652119-168652141 TTGCAGTCACATTTGCTGATGGG + Intronic
942031230 2:171962280-171962302 TTCTAGTTAGATATTCTGGTAGG - Intronic
942488135 2:176460940-176460962 TTTCAGTTAAATATGCTCATGGG + Intergenic
945743127 2:213687753-213687775 TTGAAGTTTGATATGATTCTCGG + Intronic
948254649 2:236557182-236557204 TTGGAATTAGAGATGCTGGTGGG + Intergenic
1172381987 20:34502220-34502242 ATGTAGTTAAATATGCTGCTAGG + Intronic
1173102944 20:40104546-40104568 TTGAAGTTTGAAAAGCTGTTAGG + Intergenic
1174669283 20:52291487-52291509 TGCAAGTTAGATTTGCTGTTTGG - Intergenic
1178151883 21:29804315-29804337 TGGAAACTAGACATGCTGATGGG - Intronic
949129288 3:482147-482169 TTGAATTGAGATGTGCTGTTAGG + Intergenic
952572999 3:34740324-34740346 TTCAAAATAGCTATGCTGATGGG + Intergenic
956077369 3:65519789-65519811 TTGAAGTTACAGATTGTGATAGG + Intronic
956366535 3:68509543-68509565 GTGAAAATAGATATGCTTATGGG + Intronic
956964792 3:74446333-74446355 ATGCATTTAGATATGCAGATAGG + Intronic
959754263 3:109878081-109878103 TTGAATATATATATGGTGATGGG - Intergenic
959796179 3:110430939-110430961 TTGAATTTATATTTGCTAATTGG + Intergenic
961990038 3:131179637-131179659 TTCAAGTTTGATATTCTTATTGG + Intronic
962996900 3:140638076-140638098 TTGAATTTTGATAATCTGATGGG + Intergenic
966267652 3:178065503-178065525 TTTAATTTAGCTATTCTGATAGG + Intergenic
967392588 3:188971844-188971866 TTGAAGTTAGATATGCTGATTGG + Intronic
969508907 4:7605953-7605975 GTGAAGTTACAGATGCTGAAAGG + Intronic
971776026 4:30966201-30966223 TTGCAATAATATATGCTGATTGG - Intronic
973736191 4:53873637-53873659 TGGAAGTTATATTTGGTGATGGG - Intronic
974343243 4:60641202-60641224 TTGAAGTAGAATATGCTGAAAGG - Intergenic
976561465 4:86506403-86506425 TTGAAGTTAAATAAGCTACTTGG - Intronic
978646152 4:110934185-110934207 TTGAATTTTGATTTGCTGAATGG + Intergenic
979883666 4:125995844-125995866 TTGAAATTAGCTATGCTTGTGGG + Intergenic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
982908799 4:161113572-161113594 TTGAAGTCAGGTACCCTGATGGG + Intergenic
982928319 4:161368053-161368075 TTAAATTTAGTTATTCTGATAGG + Intergenic
983739782 4:171115034-171115056 TTAAAGTTATATATGCAGCTAGG + Intergenic
985857225 5:2438977-2438999 AAGAAGTTAGAGATGCGGATCGG + Intergenic
986589948 5:9358199-9358221 TTCATGTTAGAGATGCTGACTGG - Intronic
988396309 5:30701063-30701085 TGGAAGTTACATGTGCTGTTGGG + Intergenic
988502606 5:31796097-31796119 TGGAAGTTAGTGAAGCTGATTGG - Intronic
989342014 5:40386708-40386730 TTGAATTGAAATATGCTGTTAGG + Intergenic
991436847 5:66605087-66605109 TAGGAGGTAGATATGCTTATAGG - Intronic
998941408 5:147286828-147286850 TTGTAATTAAATATGCTGACTGG + Intronic
998987645 5:147779290-147779312 TTAAAGTTAAATATTTTGATTGG - Intronic
999595673 5:153201621-153201643 CTGAAGTTAGATCTGGAGATGGG + Intergenic
1000691837 5:164332776-164332798 TTGAAGGTAAATTTGCTGACAGG - Intergenic
1001159077 5:169298533-169298555 TTGATGTTAGGTCTGCTGCTTGG - Intronic
1004359608 6:14959514-14959536 TTGAAGGTAGATCTCCTAATGGG - Intergenic
1004749442 6:18546566-18546588 CTGAAGTTATATATTCTAATTGG - Intergenic
1007370091 6:41421154-41421176 TTGAGGTTAGCTATGCTACTGGG - Intergenic
1009569564 6:65366518-65366540 TTGAATGTAAATATGGTGATAGG - Intronic
1009997391 6:70911317-70911339 TTGATTTTATATATGGTGATAGG + Intronic
1011873647 6:91928044-91928066 TAGAATTTAGACATTCTGATAGG + Intergenic
1012191268 6:96282649-96282671 CTGTAGTGAGCTATGCTGATCGG + Intergenic
1012609630 6:101200082-101200104 TTGAAGCAAGAAATGCTGTTTGG + Intergenic
1012801174 6:103830856-103830878 TTAAAGTTAGAGATGCTTAAAGG - Intergenic
1015636816 6:135284518-135284540 TTGAAGTTTGATATTATAATGGG - Exonic
1018400935 6:163418638-163418660 TTGAAGATAGAGATGATTATAGG + Intronic
1019841931 7:3455008-3455030 TTTATTTTAGATATTCTGATAGG + Intronic
1021153317 7:17178639-17178661 TCAAAGTAAGAAATGCTGATTGG - Intergenic
1021194859 7:17663935-17663957 TTATAGTTAGAGATGCTGAATGG - Intergenic
1022585983 7:31612472-31612494 TTGAACTTAGATATACTCCTAGG + Intronic
1022763622 7:33384459-33384481 TTGAAGATTGATTTGATGATTGG + Intronic
1024138484 7:46434792-46434814 ATGATGTTAGATAGGCTGATGGG + Intergenic
1024210487 7:47199138-47199160 TTGAATTTAGATGAGGTGATGGG - Intergenic
1031577391 7:123431599-123431621 TTAAAGTCAGAAATGCTAATTGG + Intergenic
1033788061 7:144757741-144757763 TTGAAGTTAGGTAGCGTGATGGG + Intronic
1039279469 8:35967967-35967989 TTGAAGTCAGATACGGTCATGGG + Intergenic
1041722238 8:60986336-60986358 TTGAACTTATTTTTGCTGATCGG + Intergenic
1042986422 8:74588851-74588873 TTGAAATTAGCTATGGTAATGGG + Intergenic
1045992395 8:108324348-108324370 TTCAAGTTAGATCTTGTGATTGG - Intronic
1046680180 8:117160272-117160294 CTAGAGTTAAATATGCTGATGGG - Intronic
1050271784 9:3953926-3953948 TTGGATTTTGATATGTTGATTGG - Intronic
1050642051 9:7678639-7678661 TTGAATGTAGATATGATAATTGG + Intergenic
1051898939 9:22017866-22017888 CTTGAGTTAGATATGTTGATGGG + Intronic
1054971463 9:71092820-71092842 TTGAAGTTAGGTAGCATGATGGG - Intronic
1055173660 9:73291012-73291034 TTGAGGTTGGATATTGTGATAGG + Intergenic
1055878768 9:80973695-80973717 TTGATGATGGAGATGCTGATGGG - Intergenic
1188740556 X:33773890-33773912 TTGAAGATAGCTATCCTGACAGG + Intergenic
1188949685 X:36355183-36355205 TTGACGTTAGCCATGGTGATAGG - Intronic
1191728537 X:64308046-64308068 TTGAAGTCACCTATGTTGATGGG + Intronic
1193592342 X:83405645-83405667 GTTAAGTTAAATATGTTGATAGG + Intergenic
1195835106 X:109105533-109105555 ATGAAGTTAAATAGGCTGAAAGG - Intergenic
1196282852 X:113843890-113843912 TTAATTTTAGATATTCTGATAGG + Intergenic
1197084214 X:122453616-122453638 TTGCAGATAGAGATGCTGTTTGG - Intergenic
1200655811 Y:5900998-5901020 TTGATGGTAGCTATGCTAATAGG + Intergenic
1201675604 Y:16580411-16580433 TTGGGGTCAGACATGCTGATTGG - Intergenic