ID: 967393408

View in Genome Browser
Species Human (GRCh38)
Location 3:188979742-188979764
Sequence ATTCATAATCAGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967393408 Original CRISPR ATTCATAATCAGAGGGAGGA GGG (reversed) Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
900811569 1:4805722-4805744 ATTCAGAATGAGAGAGAGCATGG + Intergenic
901342537 1:8508271-8508293 AGTCAAAAACAGAGAGAGGAAGG + Intronic
906315839 1:44786022-44786044 CTTTAAAATTAGAGGGAGGAGGG + Intronic
906772587 1:48498565-48498587 ATTCTTACTCAGAGGAATGAAGG - Intergenic
906790745 1:48656811-48656833 ATTCATAAAGAGGGGCAGGAGGG + Intronic
907531799 1:55106666-55106688 ATTCTTAACCAGAGAGAGAAAGG - Intronic
908163711 1:61437006-61437028 ATTCAGACTCTGAGGAAGGAGGG - Intronic
909765718 1:79353635-79353657 ATTCATAACTAGAGAGAGGTTGG + Intergenic
910200370 1:84692129-84692151 ACTCATAATGAGAGGGAAAAAGG + Intergenic
911571991 1:99528502-99528524 ATTCACAAACAGGTGGAGGATGG - Intergenic
912012247 1:104981953-104981975 TTGCATAATCAATGGGAGGAAGG + Intergenic
914434209 1:147645957-147645979 ATTCTTAGTAAGAGGGAGGAAGG + Exonic
915045660 1:153012692-153012714 ATTGATAATCAAATGAAGGAAGG + Intergenic
915909110 1:159901284-159901306 AGGCTTAATCAGAGGGAGAAGGG + Intergenic
915937263 1:160096837-160096859 TTTCATAATCAGAGTGACGGTGG + Intronic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916203586 1:162294632-162294654 ATTCATAAACAAAGAGAAGAGGG + Intronic
917101141 1:171446577-171446599 ATTCATAAGAATTGGGAGGATGG + Intergenic
917167043 1:172124186-172124208 ATTCATATTCACATTGAGGAGGG - Intronic
917656649 1:177132879-177132901 ACTCATACTCAGAGTGAGAAGGG + Intronic
918311159 1:183286434-183286456 AGTCACAATCAGAGAGAGGCAGG - Intronic
919594867 1:199548574-199548596 ATTAAAAATCAGAGGGATGAGGG - Intergenic
920438063 1:205961022-205961044 ATTCATCCTCATAGGGAGGCAGG + Intergenic
920743225 1:208600814-208600836 ATTCATAATTGCAGGAAGGAGGG + Intergenic
922029241 1:221782025-221782047 ATTCAAATTCAGGGGGAGAAAGG - Intergenic
924275940 1:242386979-242387001 ATTCATGATCAAAGGGAAAAGGG + Intronic
1063518472 10:6719862-6719884 ATTCTTAGTCACAGGAAGGATGG - Intergenic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1066233908 10:33467193-33467215 TTTTAGAGTCAGAGGGAGGAGGG + Intergenic
1067005832 10:42661073-42661095 CTACATAAACAGAGTGAGGATGG + Intergenic
1068143287 10:53032162-53032184 ATTCTTAAAAAGAGGAAGGAGGG + Intergenic
1070322915 10:75367886-75367908 TTTCAGAATCAGAGCCAGGAAGG - Intergenic
1071923431 10:90377328-90377350 ATTCATTACCATGGGGAGGAGGG + Intergenic
1072756751 10:98026633-98026655 CTTCATCTTCAGCGGGAGGAGGG - Intronic
1073444908 10:103574772-103574794 ATTTATAGTCACAGGGGGGATGG - Intronic
1073642550 10:105267784-105267806 AGCCTTATTCAGAGGGAGGAAGG + Intergenic
1076742701 10:132494930-132494952 ATTATTAAGCTGAGGGAGGAAGG + Intergenic
1078377992 11:10812276-10812298 ATTCATAAGCACAGAGAGGATGG - Intronic
1078669168 11:13349818-13349840 ACTCCTAATTACAGGGAGGAAGG - Intronic
1081041136 11:38214951-38214973 ATTTATAATCAGACAGAGCAGGG + Intergenic
1081546922 11:44078180-44078202 AATCATAATCAGATGGATCAGGG - Intronic
1083601605 11:63952149-63952171 CCTCAGAATCACAGGGAGGAAGG - Intronic
1084535960 11:69757211-69757233 ATTCCCAATCAGAAGGATGAAGG + Intergenic
1086532583 11:87803285-87803307 ACACATACTCAGAGGGAAGATGG - Intergenic
1087344899 11:96959478-96959500 AGCCAAAATCAGAGTGAGGAAGG + Intergenic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1090237787 11:125162190-125162212 CTTCATCCTCAGAGGGATGATGG + Intergenic
1092580939 12:9840632-9840654 ATTAATATTAAGAGGGAGAAAGG + Intronic
1093019390 12:14189000-14189022 ATACATAATAAAATGGAGGAAGG + Intergenic
1094083435 12:26563082-26563104 TATGCTAATCAGAGGGAGGAGGG - Intronic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1095886677 12:47195501-47195523 AAAGATAATCAGAGGAAGGAGGG - Intronic
1096244602 12:49977177-49977199 GTTGGTAATGAGAGGGAGGAGGG + Intronic
1097201040 12:57278974-57278996 ACTAATAAGCAGAGGGATGAGGG + Intronic
1098187461 12:67912840-67912862 ATTCATTGGCAGAGGGAGTAGGG - Intergenic
1100908235 12:99326497-99326519 ATTCAAAAACAGAGAGAAGAAGG - Intronic
1101397768 12:104363495-104363517 ATTCATGATGAGGAGGAGGATGG + Intergenic
1102653812 12:114463120-114463142 ATTCATCATCACATTGAGGAAGG - Intergenic
1102966935 12:117135151-117135173 ATTCAGGAGCAGAGGCAGGAGGG - Intergenic
1103886173 12:124202420-124202442 ATTCATTATCAGATGTTGGAAGG - Intronic
1106730054 13:32532027-32532049 GTTCTTAATAAGAGGGAGGCAGG - Intronic
1108529881 13:51318950-51318972 AATCATAAAAAGATGGAGGAAGG - Intergenic
1108694623 13:52892124-52892146 ATCCATAGTCTGAGGCAGGAAGG + Intergenic
1109199305 13:59412842-59412864 ATCCATCATCTGAGGGATGATGG - Intergenic
1109574960 13:64243281-64243303 TTTCACAACCAGAGGAAGGAAGG - Intergenic
1109740006 13:66541104-66541126 ATTTATAGTTAGAAGGAGGAAGG - Intronic
1110341603 13:74398174-74398196 ATTCAGAATCAGTGGGCGTATGG - Intergenic
1110530132 13:76587839-76587861 ATTCATAATTAATTGGAGGAAGG + Intergenic
1113427423 13:110220675-110220697 AATGATAGTCAGAAGGAGGACGG - Intronic
1114767396 14:25389497-25389519 GTTAAGAGTCAGAGGGAGGAAGG - Intergenic
1118660771 14:68008219-68008241 ATTTATAATCAGCAAGAGGATGG + Intronic
1119002742 14:70897768-70897790 GTACAGAAGCAGAGGGAGGAAGG + Intergenic
1119754819 14:77108772-77108794 ACTCAAAAGAAGAGGGAGGAGGG - Intronic
1121045308 14:90783382-90783404 ATTCTTTATAAGATGGAGGAAGG + Intronic
1121115711 14:91341363-91341385 AGTCAGACTCAGGGGGAGGAGGG - Intronic
1121718515 14:96093008-96093030 TTTCAGAATCAGAGATAGGATGG - Exonic
1122119753 14:99545952-99545974 ATTAATAGTCAGGGGCAGGAGGG - Intronic
1126355959 15:47796220-47796242 AGTCAGAAGAAGAGGGAGGAAGG - Intergenic
1128765556 15:70248972-70248994 AGTCACAGTGAGAGGGAGGAAGG + Intergenic
1128928228 15:71678627-71678649 GTTCATGATGAGAGGGAGAAAGG - Intronic
1133778132 16:8914032-8914054 ATTTAAAATAAGGGGGAGGATGG - Intronic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1138333030 16:56230483-56230505 ATCCATAATCAGAGCGTGGGTGG + Intronic
1140852473 16:78947990-78948012 AGTCAAAGGCAGAGGGAGGAAGG + Intronic
1141725810 16:85787574-85787596 ATTCATCAACAAAGGGAGGCAGG + Intronic
1146459783 17:33036941-33036963 ATTTAGAATCGGAGGGAGAAGGG + Intronic
1148056996 17:44805110-44805132 ATACATTATCAGAAGGAAGATGG + Exonic
1148159204 17:45440542-45440564 ATTAATCATGAGAAGGAGGATGG + Intronic
1149126928 17:53245870-53245892 CTTCATCATCAGAGGGATGTGGG - Intergenic
1149143833 17:53466034-53466056 ATGCATAAACAGAGGAAGGAAGG + Intergenic
1149534002 17:57417935-57417957 ATTCCTAGACACAGGGAGGAAGG - Intronic
1152096942 17:78278110-78278132 ATCCATACTCAGAGGGAGGTGGG + Intergenic
1152917872 17:83051437-83051459 CTTCAAAATCAGAACGAGGAAGG + Intronic
1154469097 18:14681058-14681080 CTACATAAACAGAGTGAGGATGG - Intergenic
1156689755 18:39693282-39693304 ATACATAACAAGAGAGAGGAGGG - Intergenic
1157404056 18:47408869-47408891 ATTCATAACAAGAGGGAGGAGGG + Intergenic
1158234982 18:55302577-55302599 ATTCATAATGGGAGGGAGAGAGG + Intronic
1159325691 18:66913710-66913732 TTTCAAAATCAGAGGCAGGAAGG + Intergenic
1161518695 19:4711470-4711492 AGTCCTTATCAGAGGGAGGCAGG + Intronic
1161874571 19:6897974-6897996 TTACATGATCAGAGAGAGGAAGG - Intronic
1164686372 19:30169120-30169142 CTTCCTGCTCAGAGGGAGGAGGG + Intergenic
1165664065 19:37610671-37610693 AGTCATAATAAGAGGGAGTAAGG + Intronic
1167311566 19:48740355-48740377 ACTCCGAGTCAGAGGGAGGAGGG + Intronic
1168254414 19:55157878-55157900 CTCCAGGATCAGAGGGAGGAGGG - Intronic
926455158 2:13058192-13058214 ATTGATAAACAAAAGGAGGAAGG - Intergenic
926559818 2:14403716-14403738 TTTCATAATAAGAAGGAGAAGGG + Intergenic
927675388 2:25102046-25102068 ATTCCTAATGAGAAGGAGAAAGG - Intronic
928030657 2:27775805-27775827 ATTCATTATCAGAGTGAAAAGGG + Intronic
928372838 2:30753477-30753499 TTTCATGATCAGTGGGACGACGG + Intronic
929842280 2:45480369-45480391 ATTCATAATTCATGGGAGGAGGG + Intronic
931177377 2:59867704-59867726 ACTCATCATGAGAGAGAGGAAGG - Intergenic
931229125 2:60359161-60359183 ATTCATATTGATGGGGAGGAAGG + Intergenic
931677302 2:64710006-64710028 ATTTAAAATCAGAGGGAGGCTGG - Intronic
931825800 2:65999641-65999663 GTTCATAATCAAAGAGAGAAAGG - Intergenic
932925987 2:75975133-75975155 AATCATCAGCAGAGGGAAGAGGG + Intergenic
935014200 2:99164478-99164500 ACTCATAAACAGAGGGAGCTGGG - Intronic
936025360 2:109027528-109027550 TATCATAAACAGAGGGTGGATGG - Intergenic
936597570 2:113863427-113863449 ATCCATATTGGGAGGGAGGAGGG - Intergenic
939303021 2:140371579-140371601 CTTCAAAATCAAAGGGATGAAGG - Intronic
939580419 2:143939831-143939853 ATTCAGAATAAAAGGGAGGGAGG - Exonic
940179949 2:150920929-150920951 GTTCATAAACAGAGAGATGATGG - Intergenic
940208215 2:151228051-151228073 ATTCACAATCAGAAGTAGGTGGG + Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940717180 2:157239252-157239274 ATTTATAATTAGAAGGAGCAAGG - Intergenic
941418435 2:165251626-165251648 AATTAGAATCAGAGGGAGTAGGG - Intronic
942371729 2:175293090-175293112 ATGGATCATCCGAGGGAGGAAGG + Intergenic
942572138 2:177325301-177325323 AATCAAAGTCAGAGGTAGGAGGG + Intronic
945338707 2:208623886-208623908 TTTTTTAATCAGAGGGAGGAAGG + Intronic
946065560 2:216984271-216984293 ATACTTAATCAGAGTGAAGAGGG - Intergenic
947286756 2:228525326-228525348 CTTAAGAATGAGAGGGAGGAGGG + Intergenic
1169205271 20:3736300-3736322 AATCAGAATCAGAAGAAGGATGG - Intronic
1169941492 20:10942600-10942622 ATTGAAGAGCAGAGGGAGGAAGG - Intergenic
1172033127 20:31995469-31995491 ACTTATACTCAGAGTGAGGAGGG + Intronic
1173058151 20:39636147-39636169 ATTCATAATCATTTGGAGAAGGG - Intergenic
1174288735 20:49491513-49491535 AATCATATTCAAAGGCAGGAAGG + Intergenic
1174496535 20:50948172-50948194 ATTCCCAGTCAGAGGTAGGAGGG - Intronic
1175653051 20:60745392-60745414 AATCCTAAGCAGATGGAGGAGGG - Intergenic
1175754621 20:61521702-61521724 ATTCATAATAAGAGGGGGGTGGG + Intronic
1175889216 20:62308816-62308838 ATTAATAATCAGTGGGTGGGAGG - Exonic
1176805418 21:13476590-13476612 CTACATAAACAGAGTGAGGATGG + Intergenic
1178699092 21:34818468-34818490 ATTCAGAACCAGAAGGAGGGGGG - Intronic
1179405831 21:41124998-41125020 ATTTATAATCACAGCGAGGCTGG + Intergenic
1179481956 21:41684273-41684295 ATACATCATCCGAGGGAGGCAGG + Intergenic
1181043471 22:20203786-20203808 ATAATTGATCAGAGGGAGGAGGG + Intergenic
1182065623 22:27429477-27429499 AGTCACTATGAGAGGGAGGAAGG + Intergenic
1183601347 22:38842406-38842428 ATTCATTCTTACAGGGAGGAAGG + Intronic
949279680 3:2331460-2331482 TGTCATAATCATAGGGAAGATGG - Intronic
954980436 3:54740762-54740784 ATTCCTAGTGACAGGGAGGATGG + Intronic
956015916 3:64882393-64882415 ATTCAGAAGGAGTGGGAGGAAGG - Intergenic
958767684 3:98389871-98389893 ATTCCTTATCAAAAGGAGGAAGG + Intergenic
959396092 3:105840278-105840300 ATACATAAACAGAGTGAGAAAGG + Intronic
959643177 3:108664590-108664612 ATTCCTAGTGAGAGGGAGTAAGG - Intronic
960757028 3:121025791-121025813 ATTCAAAAACAGAGGCAGTAAGG - Intronic
960902352 3:122565110-122565132 ATTCATAAAAAAAGGCAGGAAGG - Intronic
961945814 3:130686399-130686421 ATTCTAGATCAGAAGGAGGACGG - Exonic
962299214 3:134222923-134222945 ATTCAAAATGAAAGGGAGAAAGG + Intronic
962444883 3:135455387-135455409 GGTCATGATAAGAGGGAGGAAGG - Intergenic
963074497 3:141333551-141333573 ATGCCTAATCAGTGAGAGGAAGG + Intronic
964408980 3:156378863-156378885 ACCCAAAAACAGAGGGAGGAGGG + Intronic
967393408 3:188979742-188979764 ATTCATAATCAGAGGGAGGAGGG - Intronic
967845528 3:194039670-194039692 GTTCATTCTCAGAGGGAGGGAGG - Intergenic
969956101 4:10892329-10892351 AATCTTTATAAGAGGGAGGAAGG + Intergenic
975738643 4:77406679-77406701 ATTCCTAATCAGAGTGAGGGTGG + Intronic
976513371 4:85935862-85935884 TTTCAAAGTCAGAGGGGGGAAGG - Intronic
979729262 4:124003941-124003963 ATTTTTGAACAGAGGGAGGAAGG + Intergenic
980272932 4:130610552-130610574 ATCTATAATCAGAGGAAGAAAGG + Intergenic
981437328 4:144740653-144740675 ATTCATGATGAGAGGCAGGTAGG + Exonic
982244732 4:153340303-153340325 TTTCAGAATCAGAGAGAGGGTGG + Intergenic
982525346 4:156470939-156470961 ATTCAGAAGCAGAAGAAGGAAGG + Intergenic
982684990 4:158477483-158477505 AATCATTATCGGAGAGAGGAGGG - Intronic
983177499 4:164608208-164608230 GTTCGTAAGCGGAGGGAGGAGGG - Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
987718298 5:21600479-21600501 ATTTATCATAAGAGGGAGTATGG - Intergenic
990723451 5:58725442-58725464 ATAAATAATCAGAGGTAGCAAGG - Intronic
994026149 5:95086842-95086864 ATTAATAATCAGATATAGGAAGG - Intronic
995028734 5:107455329-107455351 ATTCATGATCCGAGTGAAGAGGG - Intronic
995803677 5:116027663-116027685 ATTCATTATCAGAGGAAATATGG - Intronic
995848809 5:116522989-116523011 ATTCATCAGGAGAGCGAGGAGGG + Intronic
996199487 5:120653560-120653582 AATCTTAATCAGAGGTAGGAAGG + Intronic
996395148 5:123006282-123006304 TTGCATAATCAGAGGGTGGTGGG - Intronic
996616703 5:125450626-125450648 ATTGAAGAGCAGAGGGAGGAAGG + Intergenic
997148195 5:131461079-131461101 TTTCATAATAAGTGGGAAGAAGG + Intronic
997296037 5:132769048-132769070 ATTCACAACCAAAGGAAGGAAGG + Intronic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
1000133214 5:158319905-158319927 ATAGAAAATCACAGGGAGGAGGG - Intergenic
1000289547 5:159857898-159857920 GTCCATGGTCAGAGGGAGGAAGG - Intergenic
1006988576 6:38193841-38193863 GTTCATAGTGAGAGGGAAGATGG - Intronic
1007980435 6:46150188-46150210 ATCCAAAGTCAGTGGGAGGAAGG + Intergenic
1009036066 6:58118097-58118119 TTTCATAACCAGTGAGAGGAAGG + Intergenic
1009055406 6:58328755-58328777 CTTCATTATCACAGGGAGAATGG - Intergenic
1009235759 6:61121827-61121849 CTTCATTATCACAGGGAGAATGG + Intergenic
1010452037 6:76014331-76014353 TTTGAAACTCAGAGGGAGGAAGG + Intronic
1013296712 6:108764307-108764329 ATTCACAAGGAGAGGAAGGACGG - Intergenic
1014097923 6:117480792-117480814 ATTCATAATGTGAGGCAGGTGGG - Intronic
1015455679 6:133424379-133424401 ATTCTTGAGCAGAAGGAGGAGGG - Intronic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1016275768 6:142350703-142350725 TATCATGATCAGTGGGAGGAGGG + Intronic
1016352593 6:143184142-143184164 ATGCTTAATCAGAGGGTGAAAGG - Intronic
1016379174 6:143456176-143456198 ATTTAGACACAGAGGGAGGAAGG + Intronic
1016714551 6:147209782-147209804 ATTCAGAATGACAGGGAGGAAGG + Intronic
1016772141 6:147863443-147863465 CATCATAATGAGAGGCAGGAAGG - Intergenic
1018504206 6:164446172-164446194 ATCAAAAAGCAGAGGGAGGATGG + Intergenic
1018843552 6:167537316-167537338 TTTCATAATTAGAGAGAAGAAGG - Intergenic
1021028979 7:15705707-15705729 ATTCATAAATTGAGGGAGGGAGG + Intergenic
1021541668 7:21766242-21766264 ATTCAGATTCAGAGGGAAAAAGG + Intronic
1023362769 7:39432751-39432773 TCTCAGAACCAGAGGGAGGATGG - Intronic
1026128912 7:67604424-67604446 ATTTAAAGTCTGAGGGAGGAGGG + Intergenic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1027804638 7:82801581-82801603 ATTTCTAAACAGAGGGAAGATGG - Exonic
1028061225 7:86319262-86319284 ACTACTAAACAGAGGGAGGAAGG + Intergenic
1028533849 7:91869095-91869117 TTTCATAATAAAAGGTAGGAAGG + Intronic
1030623443 7:111817406-111817428 ATCCATAATAACAGGAAGGAAGG - Intronic
1032458988 7:132095401-132095423 ATTCAGAAGCAGAGGCTGGAAGG - Intergenic
1033772564 7:144568617-144568639 AATTATAATCAGAGGGCTGATGG - Intronic
1039018400 8:33178843-33178865 ATTCTTGAGCAGAGGTAGGAGGG + Intergenic
1039580846 8:38665835-38665857 AATCAGAATCCCAGGGAGGAAGG - Intergenic
1040375752 8:46823062-46823084 TTTCATAATCACAGAGAGGAGGG + Intergenic
1041908532 8:63061548-63061570 ATTCATAACCAGAGGAATAAAGG - Intronic
1043484612 8:80686976-80686998 ATTTATAACCAGAGGATGGATGG + Intronic
1043794483 8:84519333-84519355 ATTCATATTAAGAGAGAGGATGG - Intronic
1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG + Intergenic
1045323470 8:101099378-101099400 AGTCATCATTAGAGGGAGGTAGG + Intergenic
1046099343 8:109596938-109596960 ATTCATAATGATAGGAAGAAGGG - Intronic
1046106921 8:109677587-109677609 ATTAATAAGCTGAGGAAGGAAGG + Intronic
1046955369 8:120057884-120057906 CTTCATAAACAAAGGGAGAAAGG - Intergenic
1047021664 8:120781657-120781679 ATTCATAAAAAGAGGTAGGTTGG - Intronic
1048474162 8:134728229-134728251 TTCCATGATCACAGGGAGGAAGG + Intergenic
1048525466 8:135198352-135198374 ATGAAAAATCAGAGGGAGGGAGG + Intergenic
1050766741 9:9143742-9143764 ATCCATCCTCAGAGAGAGGAAGG + Intronic
1052295761 9:26894753-26894775 ATACAGAACCAGAGGGAAGAGGG - Intergenic
1052691681 9:31823052-31823074 ATTCATAATCAGATGGAAACGGG - Intergenic
1053014211 9:34652825-34652847 ATTCTTGAGCAGAGGAAGGAGGG - Intronic
1054899248 9:70350638-70350660 ATGCTTAATCAGAGGAAGAAAGG + Intronic
1055497047 9:76866327-76866349 ATTAATAATCAGAGGTACAAGGG + Intronic
1056950077 9:91034816-91034838 ATTCAGGATCAGAGGAAGGCTGG - Intergenic
1057779639 9:98039142-98039164 AGTAAAAATAAGAGGGAGGAAGG - Intergenic
1058247449 9:102645708-102645730 ATTCATAATTAGAGAGACAAAGG + Intergenic
1059369521 9:113815830-113815852 ATTCATAAACAGCGTGATGAAGG - Intergenic
1059786737 9:117594332-117594354 ATACATAATATGAGGGATGATGG + Intergenic
1059951089 9:119463062-119463084 ATTCATCATGAGTGGGAGCAGGG - Intergenic
1061052050 9:128202706-128202728 ATTCATAGTAAGAGGGATGGAGG - Intronic
1061601030 9:131670224-131670246 ATTCAAGTTCAGAGGAAGGAGGG + Intronic
1185700368 X:2226986-2227008 ATTCATTGTCAGCAGGAGGAAGG - Intronic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1185920709 X:4088870-4088892 ATTCAGAACCAGAGGCAGCAAGG - Intergenic
1187824772 X:23323954-23323976 ATTTCTTATCAGAGTGAGGAAGG - Intergenic
1187881962 X:23855638-23855660 CTTCCTTATCAGTGGGAGGAAGG + Intronic
1188050850 X:25483944-25483966 TTTAATGATGAGAGGGAGGAGGG + Intergenic
1188437772 X:30181840-30181862 ATTCATTTTCAGTGGGAGGATGG + Intergenic
1188705184 X:33319341-33319363 ATCCATAATCAGAGAAGGGAGGG + Intronic
1190394925 X:49972350-49972372 ACACAAAAACAGAGGGAGGAAGG - Intronic
1190503560 X:51102862-51102884 CTTCATAATGAGAGGGAGAATGG + Intergenic
1190636307 X:52437423-52437445 AATCATAAACAGAGGGAGGCTGG + Intergenic
1192239160 X:69315641-69315663 TTTCATAATAAGATGGAGGCGGG - Intergenic
1193232482 X:79064754-79064776 ATTCATATTCAGAAGAATGAAGG - Intergenic
1193908512 X:87272698-87272720 TTTCATATTCAGAGGGAGCATGG + Intergenic
1194321371 X:92450280-92450302 AGTCAGAATCAGAGGTAAGATGG + Intronic
1196987967 X:121295587-121295609 ATTCCTTATAAGAGGGAGGCAGG + Intergenic
1197404235 X:126029916-126029938 ATTGGTAATCAGTGGGAGGATGG + Intergenic
1199687889 X:150280615-150280637 AATCATACTCAGAGGGATAAGGG + Intergenic
1200629541 Y:5563752-5563774 AGTCAGAATCAGAGGTAAGATGG + Intronic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201423248 Y:13821903-13821925 AGTAATAATAAAAGGGAGGATGG - Intergenic
1201504709 Y:14685422-14685444 ATTGAGAGTCAGAGAGAGGAAGG - Intronic