ID: 967398467

View in Genome Browser
Species Human (GRCh38)
Location 3:189033189-189033211
Sequence TTTGTACCAAACTAAAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967398464_967398467 14 Left 967398464 3:189033152-189033174 CCTTAAGTGAAGCTGGGAAATTT 0: 1
1: 0
2: 3
3: 31
4: 231
Right 967398467 3:189033189-189033211 TTTGTACCAAACTAAAAGCCAGG 0: 1
1: 0
2: 1
3: 3
4: 193
967398463_967398467 19 Left 967398463 3:189033147-189033169 CCATGCCTTAAGTGAAGCTGGGA 0: 1
1: 0
2: 0
3: 11
4: 186
Right 967398467 3:189033189-189033211 TTTGTACCAAACTAAAAGCCAGG 0: 1
1: 0
2: 1
3: 3
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967398467 Original CRISPR TTTGTACCAAACTAAAAGCC AGG Intronic
901397462 1:8991826-8991848 CATGTACAAAACTAAATGCCTGG + Intergenic
902540399 1:17150174-17150196 TTTGCACCAACCTAAAACTCAGG + Intergenic
904138130 1:28329794-28329816 TTTGGACCAAACTAACATCTAGG - Intronic
906391153 1:45417489-45417511 ATTGCATCAAACTAAAAGCTTGG - Intronic
908412093 1:63877145-63877167 TATGAACAAAACTGAAAGCCAGG - Intronic
909656170 1:78035049-78035071 TTTGTAACAAACTTAGAACCAGG + Intronic
910578128 1:88790441-88790463 TTTGTACCAACCTAATAGGTTGG + Intronic
911211988 1:95151041-95151063 TTTGCACCAACCTACATGCCAGG + Intronic
911713435 1:101101216-101101238 CTTGTCCCAAAATAAATGCCTGG - Intergenic
911841146 1:102683971-102683993 TTTGAACCAAAATAAAAGGAAGG + Intergenic
915656606 1:157365901-157365923 TTTGTCCCAAACTCAATTCCAGG - Intergenic
916069234 1:161160344-161160366 TTTGTACCAAACACGATGCCAGG + Exonic
916749046 1:167707808-167707830 TTTGCACCAACCTAATAGCTCGG + Intergenic
917286328 1:173425109-173425131 TTTGTACCCAATTAAAAGAAAGG - Intergenic
919016507 1:192044146-192044168 TCTATAAGAAACTAAAAGCCAGG - Intergenic
919161477 1:193836119-193836141 ATTGTACTTGACTAAAAGCCTGG - Intergenic
920826694 1:209429561-209429583 TTTGAAGCAAACTCAAAGCTAGG + Intergenic
921222864 1:212985944-212985966 TATGTACCTAACTAAAAATCAGG + Intronic
924061518 1:240180012-240180034 CTTTTACCAAACTAAAATTCAGG - Intronic
924370567 1:243345323-243345345 TTAGTACTAAATTAAAATCCTGG + Intronic
1062846940 10:714908-714930 CTTGGTCTAAACTAAAAGCCCGG - Intergenic
1063811350 10:9712650-9712672 AATGAACCAAACTAAAATCCTGG - Intergenic
1065748121 10:28860230-28860252 CTTCCACCAAGCTAAAAGCCAGG - Intronic
1065973905 10:30826099-30826121 TCTGTACCAACCTCAAAACCAGG + Intronic
1067574336 10:47398994-47399016 TTTGCACCAACCTAATAGCATGG - Intergenic
1067836557 10:49645142-49645164 CATGTACCAAGCTAAAAACCAGG + Intronic
1068678397 10:59792573-59792595 CTTTTACAAACCTAAAAGCCAGG + Exonic
1068898745 10:62240218-62240240 TTTCCACCAAACTAACAGCAAGG + Intronic
1073765343 10:106676187-106676209 TTTGTCCAAAATCAAAAGCCTGG - Intronic
1075618937 10:123911545-123911567 TTCGCACCAACCTAATAGCCAGG + Intronic
1076105968 10:127823985-127824007 TCTGTACCAAACACAAACCCAGG - Intergenic
1076789499 10:132769267-132769289 TTTGTCCTTAACTAAAAGCACGG + Intronic
1077781206 11:5331593-5331615 TTTGTACCAAAAAAAAATCGTGG - Intronic
1079090832 11:17479053-17479075 TTTGAAACAAACAAAAAGTCTGG + Intergenic
1079649235 11:22906074-22906096 TTTTTAACTAACTAAAAGTCAGG - Intergenic
1079906466 11:26253946-26253968 TTTTTCCTAAACTAAAATCCTGG - Intergenic
1081286812 11:41280441-41280463 TTTATTTCAAAGTAAAAGCCTGG + Intronic
1089710343 11:120310034-120310056 TTTTACCCAAACTGAAAGCCAGG - Intronic
1092470484 12:8774103-8774125 TTTGTACAAAAACAAAAGCAAGG - Exonic
1093911687 12:24755066-24755088 TTTGTCACACATTAAAAGCCTGG + Intergenic
1094246888 12:28308499-28308521 TCTTTCCCACACTAAAAGCCAGG + Intronic
1094289281 12:28828319-28828341 TTTGTACCAACCTAATAACTGGG + Intergenic
1094299258 12:28943269-28943291 TTTGTACAGAAATAAAAGGCAGG - Intergenic
1095044473 12:37485625-37485647 TTTGCCCCCAACTCAAAGCCTGG + Intergenic
1095100531 12:38177608-38177630 TTAGTAGCAAACTATATGCCAGG - Intergenic
1099561242 12:84176502-84176524 TTTGTAGCAAACTCAATACCTGG + Intergenic
1099810448 12:87575711-87575733 TTTATACACAACTAAAAGTCTGG - Intergenic
1106671284 13:31907983-31908005 TTTGCACCAACCTAATAGGCTGG - Intergenic
1106813727 13:33385006-33385028 TTTCTTCCAAACTAAAAATCTGG - Intergenic
1106813734 13:33385096-33385118 TTTCTTCCAAACTAAAAATCTGG - Intergenic
1106954632 13:34922576-34922598 TTTGTACCAAGTTAAAAGTAAGG - Intergenic
1107149371 13:37093863-37093885 TTTGAACCGTAATAAAAGCCAGG + Intergenic
1109140461 13:58708401-58708423 TCTGTACAAAAAAAAAAGCCAGG + Intergenic
1109933064 13:69242817-69242839 TATGTACCACACTGATAGCCTGG - Intergenic
1110476756 13:75924498-75924520 TTTGCACCAACCTAACAGCTTGG - Intergenic
1112732818 13:102385774-102385796 TTTGTCCCAAGCTAAATGTCTGG + Intronic
1113306526 13:109085167-109085189 CTGGTGCCAAACTAAAAGCTAGG + Intronic
1114071638 14:19114063-19114085 TTTGTACCAAGTTAAAAGTAGGG - Intergenic
1114090623 14:19285905-19285927 TTTGTACCAAGTTAAAAGTAGGG + Intergenic
1115097596 14:29656465-29656487 TTAGTACCTACCTCAAAGCCAGG + Intronic
1117153234 14:52910672-52910694 TTTTTACCAAATAAAAAGCTTGG + Intronic
1117608845 14:57462081-57462103 TTTGAACCAAAGGAAAGGCCAGG - Intergenic
1117959720 14:61150758-61150780 TTTGTACCTATCAAAAAGTCTGG + Intergenic
1118948622 14:70413295-70413317 TTTGCACCAACCTAATAGCATGG - Intronic
1119593268 14:75909987-75910009 TCTCCCCCAAACTAAAAGCCAGG - Intronic
1126493788 15:49267982-49268004 TATGTACCAAATTAAAATCCTGG - Intronic
1127041343 15:54980378-54980400 CTTGGACCAAACTGAAAGACAGG - Intergenic
1128431851 15:67603662-67603684 TTTGCACTGTACTAAAAGCCAGG - Intronic
1129982776 15:79889526-79889548 TGGGTCCCAAACTAAAAGTCAGG - Intronic
1130734511 15:86534157-86534179 TTTCTACCAAAGTAAAATCTGGG - Intronic
1134113554 16:11531294-11531316 TCTCTACAAAAATAAAAGCCGGG + Intergenic
1138598728 16:58042819-58042841 CTGGCACCAAACTAAAAGCAGGG + Intronic
1139043660 16:63030932-63030954 TCTGTAACAAATTACAAGCCGGG + Intergenic
1142830764 17:2547394-2547416 TATTTACCAACCTAGAAGCCAGG - Intergenic
1149587548 17:57802679-57802701 TTGCTACCAAAAGAAAAGCCTGG - Intergenic
1156784130 18:40889933-40889955 TTTAAACCAAAATAAAAGCCTGG + Intergenic
1157479205 18:48042400-48042422 TTTGTACCAAGATAAGGGCCAGG - Intronic
1165483003 19:36076592-36076614 TTTGTACTAAAAAAAAACCCTGG - Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1166593872 19:44027262-44027284 TTTGCACCAACCTAATAGCCAGG - Intronic
1167929453 19:52852378-52852400 TTTTTACAAAAATAACAGCCAGG + Intronic
1168527012 19:57096864-57096886 TTTCCACCAAGCTAAAGGCCAGG + Intergenic
926706640 2:15842191-15842213 TTTGTAACAATCTGAAAGCTGGG - Intergenic
927384611 2:22518568-22518590 TTAAGTCCAAACTAAAAGCCTGG + Intergenic
927482067 2:23461934-23461956 TTTGCACCAAACTAATACCTGGG - Intronic
927727881 2:25441742-25441764 TCTGTATCAAATTCAAAGCCAGG + Intronic
932851210 2:75188835-75188857 TTGGAACCATACTAAGAGCCTGG + Intronic
932919609 2:75895831-75895853 TTTGTACAAAAATAAAACACAGG - Intergenic
938485895 2:131707625-131707647 TTTGTACCAAGTTAAAAGTAAGG - Intergenic
939714817 2:145570849-145570871 CTTGTACCAAACCACATGCCAGG + Intergenic
941293290 2:163702944-163702966 TTTGCCCCATACTAAAAGCTCGG + Intronic
943975317 2:194469287-194469309 TTTGCACTAAAGTATAAGCCTGG + Intergenic
944483106 2:200177446-200177468 TTTGTACCTAACTAAATGCCAGG + Intergenic
948116208 2:235495439-235495461 TTTGTACCAACCAAAAGTCCGGG + Intronic
1169090022 20:2854049-2854071 TCTGGACAAAACTGAAAGCCTGG - Intronic
1169908169 20:10624283-10624305 TCTGTCCCAAACCAAAATCCTGG - Exonic
1170030338 20:11937804-11937826 TTTGTAGCAACCTGGAAGCCAGG + Intergenic
1170860405 20:20097997-20098019 TTTGTACCCCACCATAAGCCTGG - Intronic
1171137186 20:22706633-22706655 TTTGGACAAAACCAAAAGCAAGG - Intergenic
1171778445 20:29393923-29393945 TTAGTAGCAAACTATATGCCAGG + Intergenic
1171820218 20:29829214-29829236 TTAGTAGCAAACTATATGCCAGG + Intergenic
1171897618 20:30823951-30823973 TTAGTAGCAAACTATATGCCAGG - Intergenic
1173404012 20:42749221-42749243 TTTGTACCAGAATAGGAGCCTGG - Intronic
1176385799 21:6138076-6138098 TTTGTACCAAACCGAATGCACGG - Intergenic
1178264065 21:31126049-31126071 TTTGTACCAACCTAATACCTTGG + Intronic
1178830409 21:36051692-36051714 TTTGTACAAAAACAAAAGCAAGG - Intronic
1179737674 21:43400176-43400198 TTTGTACCAAACCGAATGCACGG + Intergenic
1179832923 21:44009536-44009558 TTTGTACAGCACTTAAAGCCAGG + Intergenic
1180324218 22:11353914-11353936 TTAGTAGCAAACTATATGCCAGG + Intergenic
1180490082 22:15836394-15836416 TTTGTACCAAGTTAAAAGTAAGG - Intergenic
1181181851 22:21074043-21074065 TTTGTACCAAAGGAAATGCGAGG - Intergenic
1183595969 22:38811927-38811949 TGTGTAACCCACTAAAAGCCTGG + Intergenic
950028861 3:9838758-9838780 TTTGTACCAGACTCAAAGAATGG + Intronic
953382502 3:42483761-42483783 TTGCTACCAAAATAAAATCCAGG + Intergenic
957086711 3:75686633-75686655 TTAGTAGCAAACTATATGCCAGG - Intergenic
958603096 3:96324486-96324508 TTTGTACTAAACTCAAAGATTGG + Intergenic
958941257 3:100317418-100317440 TTTGAAACAAACAAAAAACCTGG - Intronic
962496244 3:135943064-135943086 TTTGTGCAGAACTAATAGCCAGG - Intergenic
965529439 3:169756582-169756604 TTTGTACCAAACTCTCATCCTGG - Intergenic
966564436 3:181360787-181360809 TTTCAACCATACTAAAAGCTGGG + Intergenic
967398467 3:189033189-189033211 TTTGTACCAAACTAAAAGCCAGG + Intronic
969576840 4:8041011-8041033 CTTGTGTCAAACTAAGAGCCGGG + Intronic
970162814 4:13206319-13206341 TTTGAAACACACTAAAAGACCGG + Intergenic
970245846 4:14061989-14062011 TTTATACCAAACTACAGGTCAGG + Intergenic
970551702 4:17188295-17188317 AATGTACTAAACTAAAAGCACGG + Intergenic
970675602 4:18446243-18446265 TTTGCACCAAACTAATATCATGG + Intergenic
971094046 4:23377915-23377937 TTTGTACTGAACTATTAGCCAGG + Intergenic
974783524 4:66586239-66586261 AATGTACCAAATTAAAAGCTTGG + Intergenic
975421565 4:74170543-74170565 TTTATACAACACTAAAAGCATGG + Intronic
975512255 4:75207000-75207022 CTACTACCAGACTAAAAGCCAGG + Intergenic
976461706 4:85319931-85319953 TTTGTCCCAAACTCAATTCCAGG - Intergenic
977256309 4:94744306-94744328 TTTGTTTAAAACTAACAGCCAGG - Intergenic
979347743 4:119608763-119608785 TTTATACCAAACAAAAGTCCAGG + Intronic
980578611 4:134718026-134718048 TATGTGCAAAACTAAAATCCAGG + Intergenic
981107711 4:140900021-140900043 TTTGCACCAAACTAATCTCCAGG - Intronic
981724190 4:147830438-147830460 TTTGTACCAACCTAATAGTTTGG - Intronic
981831159 4:149003786-149003808 TTCATATCGAACTAAAAGCCAGG + Intergenic
982972679 4:162011019-162011041 TGTGTATCAAAATAAAATCCAGG + Intronic
983039999 4:162914235-162914257 TTTGCACCAACCTAATATCCTGG - Intergenic
986948765 5:13056585-13056607 TTGGTACCAAACTAACTGCAGGG + Intergenic
988109972 5:26807557-26807579 TTTGCTCCAAAATAAGAGCCAGG - Intergenic
988876562 5:35453621-35453643 TTTGTATAATACTAAAAGCTAGG - Intergenic
988923222 5:35963362-35963384 TTTGTCCCAAACTCAATTCCAGG - Intronic
991749108 5:69780001-69780023 TTTGGAATAAACAAAAAGCCAGG - Intergenic
991800689 5:70359812-70359834 TTTGGAATAAACAAAAAGCCAGG - Intergenic
991827911 5:70650229-70650251 TTTGGAATAAACAAAAAGCCAGG + Intergenic
991893048 5:71359252-71359274 TTTGGAATAAACAAAAAGCCAGG - Intergenic
992479656 5:77137983-77138005 TTTGTACCAACCTAATAGAAAGG - Intergenic
993731572 5:91429039-91429061 TTTTTACCAGACTAAAATCAAGG - Intergenic
994285589 5:97961680-97961702 TTTGTTCCAAAATAAAATTCAGG - Intergenic
995320168 5:110824961-110824983 TTTGTCCCAAACTCAATTCCAGG + Intergenic
997692550 5:135836335-135836357 TTTGCACCAAACTAATAACATGG + Intronic
998757369 5:145395537-145395559 TTTGTAATAAATTAAAAGTCTGG - Intergenic
1000557302 5:162741822-162741844 GTTGAACCAAACTAATATCCCGG + Intergenic
1001968611 5:175935276-175935298 TTTGTACCAACCTAATAGAATGG + Intronic
1002248832 5:177908468-177908490 TTTGTACCAACCTAATAGAATGG - Intergenic
1003184087 6:3815514-3815536 TTAGTACAAGACTAAAAACCAGG - Intergenic
1005119516 6:22374237-22374259 TTTGAACCATCCAAAAAGCCAGG - Intergenic
1005468185 6:26135862-26135884 TTTGTACCAACCTAATAGAATGG + Intronic
1005511415 6:26515145-26515167 TTTGTACCTAACCAACAGCATGG - Intergenic
1008125186 6:47660093-47660115 TTTGTACAAGAACAAAAGCCTGG + Intronic
1009543548 6:64996884-64996906 TAAGTAACAAACTATAAGCCTGG + Intronic
1014914074 6:127123813-127123835 TTTGTACAATATTAAATGCCAGG - Intronic
1016644294 6:146387477-146387499 TTTTAAGCAAAATAAAAGCCGGG - Intronic
1020302196 7:6804417-6804439 TTTGTCTCAAAAAAAAAGCCAGG + Intronic
1020661833 7:10992806-10992828 TTTCTAACAAAATCAAAGCCAGG + Intronic
1021898680 7:25262007-25262029 TTTGTGACAAACTAACAGCAGGG + Intergenic
1024852114 7:53730927-53730949 TTTGTACCAACCTAATAGTTTGG + Intergenic
1025290398 7:57715167-57715189 TTTGCCCCCAACTCAAAGCCTGG + Intergenic
1033303433 7:140206768-140206790 TTTGTAACAATCGAAAACCCTGG - Intergenic
1037383436 8:18312647-18312669 TTTGTGCCCAGCTAAAAACCAGG - Intergenic
1042415391 8:68512410-68512432 TTTGAACCATTCAAAAAGCCAGG + Intronic
1044549042 8:93491904-93491926 TTTGCACTAAACAGAAAGCCAGG - Intergenic
1045659768 8:104425421-104425443 TTTGCACCAACCTAATAGCTGGG + Intronic
1047138619 8:122109092-122109114 TTTGCACCAACCTAAATACCTGG + Intergenic
1051685290 9:19652210-19652232 TCTTCACCAAACAAAAAGCCAGG - Intronic
1052335481 9:27315121-27315143 TTTTCCTCAAACTAAAAGCCTGG - Intergenic
1053164797 9:35836764-35836786 TTGGTACCAAACTGGAACCCTGG + Intronic
1053601664 9:39617145-39617167 TTAGTACTAAACTAGAAGCAGGG - Intergenic
1053750184 9:41245756-41245778 TTAGTAGCAAACTATATGCCAGG - Intergenic
1053859312 9:42370912-42370934 TTAGTACTAAACTAGAAGCAGGG - Intergenic
1054251871 9:62725301-62725323 TTAGTACTAAACTAGAAGCAGGG + Intergenic
1054255683 9:62810095-62810117 TTAGTAGCAAACTATATGCCAGG - Intergenic
1054335628 9:63805512-63805534 TTAGTAGCAAACTATATGCCAGG + Intergenic
1054565984 9:66759802-66759824 TTAGTACTAAACTAGAAGCAGGG + Intergenic
1056977933 9:91277427-91277449 TATATCTCAAACTAAAAGCCAGG + Intronic
1057870451 9:98712798-98712820 TTTGTACCAAACTAATATATAGG + Intergenic
1059469136 9:114490929-114490951 ATTATAACAGACTAAAAGCCAGG - Intronic
1060429001 9:123532351-123532373 TTTATACCAAAAGAAAATCCTGG + Intronic
1060799960 9:126537655-126537677 TTTGCACCAACCTAATAGCATGG + Intergenic
1203371879 Un_KI270442v1:314486-314508 TTAGTAGCAAACTATATGCCAGG + Intergenic
1188073813 X:25750387-25750409 TATGTTCCAAAGTTAAAGCCAGG + Intergenic
1190396886 X:49994023-49994045 TTGGTACCAAATTAAATACCGGG + Intronic
1190886970 X:54539033-54539055 TTTGTAGAAAATAAAAAGCCAGG + Exonic
1192734739 X:73839505-73839527 TCTGAACCAAACTCAGAGCCAGG + Intergenic
1197894428 X:131296234-131296256 TTTGTGCCAAATGAAAGGCCAGG + Intronic
1198969506 X:142266054-142266076 TTTATACCAAACCAAAATCAGGG - Intergenic
1200345475 X:155442491-155442513 TGTGTGCCAACCTAAAACCCAGG + Intergenic