ID: 967403660

View in Genome Browser
Species Human (GRCh38)
Location 3:189092631-189092653
Sequence CACGCTGCTCAGAGTGCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967403652_967403660 18 Left 967403652 3:189092590-189092612 CCTGTTGCTTATCTATTGCTGTG 0: 1
1: 0
2: 3
3: 33
4: 270
Right 967403660 3:189092631-189092653 CACGCTGCTCAGAGTGCACTGGG 0: 1
1: 0
2: 0
3: 15
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967403660 Original CRISPR CACGCTGCTCAGAGTGCACT GGG Intronic
903757939 1:25676074-25676096 CTCGCTGCTCAAAGTGCTCCAGG - Intronic
904596757 1:31651540-31651562 CACGGTCCTCAAAGTCCACTGGG - Intergenic
905257532 1:36694545-36694567 CACTCTTCTCAGGGTGCAGTGGG - Intergenic
908025959 1:59951878-59951900 AGCGCTGCTCAGAGGGCAATAGG - Intergenic
912327786 1:108785118-108785140 CCCGCTTCTCACAGTTCACTAGG + Intronic
916280465 1:163045793-163045815 CACTTTGCTCAGAGAACACTTGG + Intergenic
918302649 1:183218183-183218205 AGTGCTGCTCAGAGTGTACTTGG - Intronic
919792666 1:201302317-201302339 CACCCCGCTCAAAGTCCACTGGG - Intronic
920007678 1:202845248-202845270 CAGGCTGCCCAGAGTGCCCCAGG + Intergenic
923126307 1:231037661-231037683 CAGGCTTCTCAGAGTCCACTCGG + Intronic
923537609 1:234865030-234865052 CACGCTGCTCAGAGAGACGTGGG - Intergenic
1063038380 10:2311978-2312000 CACCCTGGCTAGAGTGCACTGGG - Intergenic
1063071901 10:2675240-2675262 CACGCTGCTGAGATTACACAGGG - Intergenic
1071672220 10:87619221-87619243 CATGGTGCTCACAGTGCAGTGGG - Intergenic
1075310283 10:121407920-121407942 CACGCTCCTCTGAATGCTCTAGG - Intergenic
1075664779 10:124222512-124222534 CAGGCTGCTCACAGTCCAGTGGG + Intergenic
1076617139 10:131762984-131763006 CATGCTCCTGAGAGTTCACTGGG + Intergenic
1077158338 11:1101473-1101495 CATGCTGCGCAGAGTGCCATGGG - Intergenic
1077279144 11:1734166-1734188 CAAGCTGATGAGGGTGCACTAGG - Exonic
1078898389 11:15618410-15618432 TAAGCTGCTCAGAGTGTGCTGGG - Intergenic
1085087412 11:73679467-73679489 CAGGCTGCAAAGGGTGCACTTGG + Intronic
1095548383 12:43400515-43400537 CATGCTGCTTAGAGCACACTTGG + Intronic
1099446234 12:82754979-82755001 AAAGCTGCTCAGATAGCACTTGG - Intronic
1103276262 12:119713980-119714002 CCTGCTGCTCAGAGTGCCTTAGG - Intronic
1105841649 13:24259072-24259094 CACCCAGCTCAGAGTGCACAAGG - Intronic
1109205099 13:59474186-59474208 TACATTCCTCAGAGTGCACTAGG - Intergenic
1112407820 13:99136609-99136631 CACGCTGCTCAGAGCACTCCAGG + Intergenic
1114535207 14:23418191-23418213 CAGGCTGCTCAGAACTCACTTGG + Exonic
1114556700 14:23566359-23566381 CATGGTGCTCAAAGTGCACAAGG + Exonic
1115536714 14:34379927-34379949 CACTCTGCTCACAGGGCCCTTGG - Intronic
1119442503 14:74637698-74637720 CACACTGCTCTGTGAGCACTGGG + Intergenic
1119923645 14:78471117-78471139 CACACTGAACAGAGTGGACTTGG + Intronic
1127399912 15:58575259-58575281 CACGCTGCTCAGCGTGGCCTGGG - Intergenic
1140632347 16:76868793-76868815 AACACTGCTCAGAGTCCTCTGGG + Intergenic
1142595404 17:1027333-1027355 AACCCTGCTCTGAGTGAACTTGG - Intronic
1143372315 17:6447886-6447908 GACGCTGCTCAGGGTGCCCCTGG - Intronic
1144790177 17:17853664-17853686 CACGCTGAGGAGAGTGCACTGGG + Intronic
1147887935 17:43697170-43697192 CACTGTGCTCAGTGGGCACTGGG + Intergenic
1147935469 17:44008110-44008132 CACCCTGCTCTGTGAGCACTAGG + Intronic
1149389656 17:56176089-56176111 CACCCTGCTGTGAGTCCACTGGG + Intronic
1151679352 17:75615428-75615450 CTCGCTGCCCACTGTGCACTCGG - Intergenic
1158189092 18:54805090-54805112 GAGGATGCTCAGAGTGCCCTTGG - Intronic
1158422362 18:57306504-57306526 CATGATGCTCAGAGTACAGTGGG - Intergenic
1159002472 18:62986694-62986716 CACCCTGGGCAGAGTGCAGTGGG + Intergenic
1160136322 18:76274611-76274633 CACACTGCTCAGAGTGAGCTGGG - Intergenic
1161498629 19:4600861-4600883 CTCCCTTCTCAGAGTTCACTGGG + Intergenic
1163753815 19:19094637-19094659 GACGCTGTACAAAGTGCACTTGG - Intronic
1164593321 19:29518012-29518034 CCCTCTGCTCAGAGGGCACTGGG - Intergenic
1167379486 19:49130247-49130269 CATGCTGGTCAGAGTCCACGGGG - Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167780266 19:51594420-51594442 CACGCCTCCCAGAGTGTACTAGG - Intergenic
926092177 2:10058242-10058264 CTCGCTCCTCAAAGTGCAGTTGG + Exonic
927314311 2:21664356-21664378 CACTCTGCTCTGAGTTCACGTGG - Intergenic
929818659 2:45256698-45256720 CCCACTGCTCAGAGTCCACTTGG - Intergenic
931691490 2:64838078-64838100 CAAGCTGGGCAGAGTGCCCTGGG + Intergenic
932432882 2:71686080-71686102 CAGGGTGCTCAGAGTCCTCTGGG + Intronic
935431264 2:102978342-102978364 CACGTTGCTCAGAGGGCATATGG + Intergenic
939215848 2:139237225-139237247 CACCCTGCTCTGTGTGCCCTGGG - Intergenic
942526057 2:176854149-176854171 CACACTAATCAGAGTGAACTTGG + Intergenic
1171388624 20:24786817-24786839 AGAGCTGCTCAGAGAGCACTCGG + Intergenic
1172095668 20:32458912-32458934 CACGCTGCTCAGGGTGCTCCTGG + Intronic
1172485184 20:35293690-35293712 CCCACTGCCCACAGTGCACTGGG - Intergenic
1172848457 20:37944285-37944307 CACGCTGTACAGAGTGCATGAGG + Exonic
1175656213 20:60773151-60773173 CCCCGTGCTCAGAGTGCACTGGG - Intergenic
1175698053 20:61117219-61117241 CACTCAGCTCACAGAGCACTGGG - Intergenic
1175701122 20:61137869-61137891 GTGGCTGCCCAGAGTGCACTGGG - Intergenic
1175787850 20:61723346-61723368 CACGGTGCTCAGAGGGCCCCGGG - Intronic
1175794390 20:61762573-61762595 CAGGCTGGACAGAGTGCAGTGGG - Intronic
1179961862 21:44772152-44772174 GGCGCTGCTCAGAATGCACGTGG + Intronic
1180711373 22:17841857-17841879 CACGCTGCTCAGGTTGTGCTCGG + Exonic
1182699961 22:32228669-32228691 CAGGCTGCTCAGGGTCCCCTGGG + Intronic
1185168188 22:49275168-49275190 CACGCGGCTCTGAGTTCACTAGG + Intergenic
953932080 3:47010438-47010460 CCCGCTGCTCAGAGTAGGCTGGG + Intergenic
953979953 3:47408645-47408667 CACCCTGCTCAGTGTGCGCTGGG + Intronic
954259013 3:49425381-49425403 CAGGTTGCTCACAGGGCACTGGG + Exonic
954754703 3:52832849-52832871 GACACTGCTCAGAGTGAAGTGGG - Intronic
958079925 3:88734406-88734428 TATGCTCCTCAGAGTGCACGTGG + Intergenic
960194265 3:114746106-114746128 CATGCTGATCAGATTGCCCTGGG + Intronic
961583610 3:127903648-127903670 CACCCTGCTCACATTCCACTGGG - Intergenic
962350215 3:134650900-134650922 CATGCTGCTGATCGTGCACTCGG - Exonic
967403660 3:189092631-189092653 CACGCTGCTCAGAGTGCACTGGG + Intronic
968483991 4:849996-850018 CACGCTGCACACAGTGCTGTGGG - Exonic
969087151 4:4664991-4665013 TGCAATGCTCAGAGTGCACTTGG + Intergenic
969102027 4:4776554-4776576 CACGAAGCTCATAGTGCACTGGG + Intergenic
974181985 4:58395934-58395956 CAGGCTGGTCCTAGTGCACTTGG - Intergenic
974644114 4:64670986-64671008 GAAGCTGCTTACAGTGCACTTGG - Intergenic
978411440 4:108430383-108430405 CATGCTTCTCTGAGTGCTCTGGG - Intergenic
979084597 4:116390908-116390930 CACCCTGCTCTCAGTGGACTTGG + Intergenic
984694316 4:182764371-182764393 CAAGGAGCTCAGAGTCCACTGGG + Intronic
984948442 4:184988529-184988551 CAACCTTCTCAGAGTGGACTGGG - Intergenic
985619545 5:946977-946999 CACGCTCCTCAGCGTGACCTTGG + Intergenic
985937000 5:3105047-3105069 CAGGATGGTCAGAGGGCACTGGG - Intergenic
991612080 5:68459860-68459882 CACGGCACTCAGATTGCACTGGG - Intergenic
992000766 5:72434114-72434136 CTTGCTACTCAGAATGCACTTGG - Intergenic
995637076 5:114205431-114205453 CATGCCACTTAGAGTGCACTGGG + Intergenic
997991956 5:138551965-138551987 CATGCTGTTCAGAGTGCTGTAGG + Intergenic
1000151732 5:158508981-158509003 CACTCTCCTTAAAGTGCACTGGG - Intergenic
1002856609 6:1043558-1043580 CACGCTGTACAGAGTGCTCCAGG - Intergenic
1003131968 6:3402430-3402452 AACACTACCCAGAGTGCACTAGG + Intronic
1003131975 6:3402475-3402497 CACACTACCCAGAGTGCACTAGG + Intronic
1003131986 6:3402519-3402541 CACACTACACAGAGTGCACTAGG + Intronic
1003131991 6:3402563-3402585 CACACTACCCAGAGTGCACTAGG + Intronic
1006439436 6:34043882-34043904 CACGCTGCTGTGACAGCACTGGG - Intronic
1007678026 6:43614308-43614330 CACACTTCTCACAGGGCACTTGG - Exonic
1010039505 6:71364486-71364508 CAGGCTGCTGAGATTTCACTTGG + Intergenic
1013426422 6:110017032-110017054 TAGGCTGCTCAGTGTGAACTAGG + Intergenic
1017757315 6:157540296-157540318 AACCCTGCAGAGAGTGCACTTGG + Intronic
1018092708 6:160358829-160358851 CCCTCTGCTCAGACTGCAATTGG - Intronic
1021905218 7:25326621-25326643 CACAAGGCTCAGAGTGCACAAGG + Intergenic
1029156685 7:98522226-98522248 CCAGCTGCACAGAGGGCACTAGG - Intergenic
1032500985 7:132399564-132399586 CACTCTTCCCAGACTGCACTAGG - Intronic
1033583120 7:142754251-142754273 CACGCTGCTCTGTGGACACTTGG - Intronic
1045980519 8:108181713-108181735 CACCCTGGCCAGAGTGCAGTGGG + Intergenic
1048993311 8:139774055-139774077 CAGGCTGCTGAGAGCGCAGTGGG + Intronic
1049218107 8:141416985-141417007 CACCCTGCTCTGAGGGCCCTGGG + Intronic
1054463594 9:65479730-65479752 CCCCCTGGGCAGAGTGCACTGGG + Intergenic
1059451072 9:114371807-114371829 CACTCTGCTCAGAGCCCACGGGG - Intronic
1061368971 9:130187307-130187329 CACGGTGCTCAGAGAGCAGGAGG - Intronic
1061442642 9:130616747-130616769 AAGGCTGCTCAAAGTTCACTGGG - Intronic
1062721227 9:138045259-138045281 CACGCTTCTCAGTGTGCTCCGGG - Intronic
1185771480 X:2768435-2768457 CAAGCTGCTCAGACTGGGCTGGG - Intronic
1189627967 X:42920074-42920096 CACGGGGCTCAGAGTGCTCCAGG - Intergenic
1190070249 X:47273527-47273549 CAGGTTGCTCACAGGGCACTGGG + Intergenic
1193441211 X:81540858-81540880 CATGCTGCTCATAGTCCATTGGG + Intergenic
1195248111 X:103015181-103015203 GAGGCTGCTCAGAGTCCTCTAGG - Intergenic
1201299079 Y:12490471-12490493 CAAGCTGCTCAGACTGGGCTGGG + Intergenic