ID: 967409225

View in Genome Browser
Species Human (GRCh38)
Location 3:189150695-189150717
Sequence GCCTCGGAGAAACTTCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967409225_967409230 28 Left 967409225 3:189150695-189150717 CCTCAGTGAAGTTTCTCCGAGGC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 967409230 3:189150746-189150768 ATTTTGAATAAAAATGAGCGAGG 0: 1
1: 0
2: 2
3: 27
4: 365
967409225_967409229 1 Left 967409225 3:189150695-189150717 CCTCAGTGAAGTTTCTCCGAGGC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 967409229 3:189150719-189150741 AGATGGTCACATTGATTTTCTGG 0: 1
1: 0
2: 0
3: 15
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967409225 Original CRISPR GCCTCGGAGAAACTTCACTG AGG (reversed) Intronic
900481608 1:2902246-2902268 GCCTCTCACAAACTCCACTGAGG - Intergenic
900846748 1:5109823-5109845 GCCTTGGTGAAACTCCATTGTGG - Intergenic
908695862 1:66841061-66841083 GACACCCAGAAACTTCACTGAGG + Intronic
911714101 1:101110722-101110744 GCCTCGGAAACACCTCACCGTGG + Intergenic
914743352 1:150483312-150483334 GCCTAGGACACCCTTCACTGTGG + Intergenic
920493597 1:206438215-206438237 GCTGAGGAGAAATTTCACTGGGG - Intronic
923267520 1:232328934-232328956 GCCACAGAGAGACTTCACTTGGG - Intergenic
1066370156 10:34813886-34813908 GCTTGGGAGAAACTTCAGCGTGG + Intronic
1069805998 10:71125451-71125473 GCCTGGGGGAAACTGCAGTGTGG + Intergenic
1071625985 10:87170545-87170567 GCCTCGGAGGAAGATCTCTGAGG - Exonic
1074777849 10:116779346-116779368 GCCTGGGTGAATCTTCAATGGGG + Intergenic
1076269790 10:129141763-129141785 GCCTCGGGGAAAATTGAATGGGG + Intergenic
1079190211 11:18270658-18270680 GCCTCATAGAAACATCATTGAGG - Intergenic
1083624472 11:64065094-64065116 GCCTCGGAGAGACTTCCCAGAGG + Intronic
1085370112 11:75994659-75994681 GGCTCAGAGACACTTCCCTGAGG + Intronic
1087743749 11:101918671-101918693 CCCTTGGAGAAAATTCTCTGGGG - Intronic
1089004859 11:115082834-115082856 GCCTGGGAGAATCTTACCTGGGG + Intergenic
1092921792 12:13238317-13238339 GCCAATGAGAAACTTCAGTGTGG - Intergenic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1097663168 12:62452712-62452734 GGCTGGCAGGAACTTCACTGAGG - Intergenic
1102747648 12:115263600-115263622 GCCTTCCAGAATCTTCACTGGGG - Intergenic
1106109402 13:26763229-26763251 GCCTGGAAGAAACTTGTCTGGGG - Intergenic
1106804489 13:33292300-33292322 GCCTGGGAAAATCTTCCCTGGGG - Intronic
1110623811 13:77629183-77629205 GCCTCAGAGAGATTTCACTTGGG + Intronic
1118088930 14:62450764-62450786 GACTCAGAGAAAGTTCTCTGTGG - Intergenic
1119804754 14:77475463-77475485 GCCTCGGACCAACCTCACTGGGG + Exonic
1120726927 14:87954188-87954210 GCCTCGGAGGAAGATCTCTGAGG - Intronic
1121173857 14:91875782-91875804 GACAGGGAGAAACTTCACAGTGG + Intronic
1124509546 15:30311660-30311682 GGCCCCTAGAAACTTCACTGAGG - Intergenic
1124734014 15:32227002-32227024 GGCCCCTAGAAACTTCACTGAGG + Intergenic
1124867204 15:33504086-33504108 TCCTTGGAAAAACCTCACTGGGG + Intronic
1126756917 15:51934129-51934151 GTCCCCCAGAAACTTCACTGAGG + Intronic
1128309501 15:66621653-66621675 TCCTCGGAGAAACAGCTCTGGGG - Intronic
1128802617 15:70506285-70506307 GCCTTGGAGAAACTCCAGAGGGG + Intergenic
1129775646 15:78234660-78234682 AATTCTGAGAAACTTCACTGAGG - Exonic
1130070231 15:80640819-80640841 GGGTCAGAGGAACTTCACTGAGG - Intergenic
1131824114 15:96303678-96303700 GCCACTGAGACACTTCAATGGGG - Intergenic
1131979000 15:97977542-97977564 ACATCTGAGAAACTGCACTGAGG + Intergenic
1132370443 15:101294298-101294320 GCCTCGGAGCAGCATCGCTGCGG - Intronic
1132502312 16:290026-290048 TCCTCCGACAAACTTCGCTGCGG - Intronic
1140590025 16:76340590-76340612 GCATCGGAGAAAGTTTAGTGAGG - Intronic
1142574640 17:898427-898449 TCCTCTGAGAAACTACTCTGAGG + Intronic
1142574659 17:898560-898582 TCCTCTGAGAAACTACTCTGAGG + Intronic
1142745660 17:1956367-1956389 GCCTCGGAGAGTCATCAGTGGGG + Intronic
1145758463 17:27409864-27409886 GCTGCGGAGAAACATCACGGGGG - Intergenic
1145817608 17:27806575-27806597 GCCTCAGAGACCCTTAACTGAGG - Intronic
1146981430 17:37165601-37165623 GGCTGGGAGAAGCTTTACTGAGG - Intronic
1148604017 17:48915241-48915263 GCCTAATAGTAACTTCACTGGGG - Intronic
1148762577 17:50014594-50014616 CCCTCAGAGAAACTCCACTAGGG - Intergenic
1149759056 17:59213048-59213070 GCCTGGGAGATACTCAACTGTGG - Exonic
1151623504 17:75261911-75261933 TCCTCGGGCAACCTTCACTGCGG - Exonic
1151651360 17:75472000-75472022 GCCTGGGAGATCCTTAACTGGGG + Intronic
1154111608 18:11573317-11573339 GGCTCCCAGAAACTTCACTCTGG - Intergenic
1154129198 18:11722273-11722295 GCCACTCAGAAACTTAACTGGGG + Intronic
1155375598 18:25153601-25153623 GCATCTGGGAAACTGCACTGCGG + Intronic
1157548060 18:48561509-48561531 TTCTCAGAGAAACTCCACTGTGG + Intronic
1158531772 18:58269011-58269033 CCCTGGCAGAAACCTCACTGGGG + Intronic
1160392147 18:78541991-78542013 GCCTCGGAGAACATGCAGTGTGG - Intergenic
1160429873 18:78804000-78804022 TCCTCGGAGCAGCTTCACTGGGG - Intergenic
1164887663 19:31796232-31796254 GCACCAGAGAAACTTCACAGTGG + Intergenic
1167281235 19:48570134-48570156 GCCTGGGAGAGCCTTCCCTGTGG + Intronic
926052108 2:9751915-9751937 GACTGGAAGACACTTCACTGTGG - Intergenic
933982888 2:87567850-87567872 GCAGGGGAGAAACTTCACAGTGG + Intergenic
934548133 2:95235659-95235681 GCCACTGAGAAAGTTTACTGGGG - Intronic
936310951 2:111382944-111382966 GCAGGGGAGAAACTTCACAGTGG - Intergenic
938343769 2:130552083-130552105 GCCTGGGAGAAAATTCTCTGTGG + Intergenic
938346064 2:130568639-130568661 GCCTGGGAGAAAATTCTCTGTGG - Intergenic
946249749 2:218405022-218405044 GCCCTGGAGAAGCTGCACTGTGG - Exonic
1174849308 20:53976813-53976835 TGCCCAGAGAAACTTCACTGTGG - Intronic
1176010365 20:62890227-62890249 GCCACGGAGACACTTCAGTTGGG + Intronic
1180253881 21:46609018-46609040 ACCTGCTAGAAACTTCACTGAGG - Intergenic
1184668793 22:46002146-46002168 GCACCGGAGAGACCTCACTGTGG - Intergenic
953151850 3:40332253-40332275 GCTTGGGAGAAACTTCCCTGGGG - Intergenic
957160695 3:76605825-76605847 GCCTGGGAGAAAATACACTTTGG + Intronic
959510038 3:107200217-107200239 AGCTAGGAGAAACTTCCCTGGGG + Intergenic
964591871 3:158373564-158373586 TCCTGGGAGAAACATCACTTGGG + Intronic
965239990 3:166183750-166183772 GTTCAGGAGAAACTTCACTGAGG + Intergenic
965531441 3:169773820-169773842 GTTTTGGAGAAACTGCACTGGGG + Intronic
966207603 3:177420980-177421002 GCCTGGGAGACACTTAGCTGGGG + Intergenic
967409225 3:189150695-189150717 GCCTCGGAGAAACTTCACTGAGG - Intronic
969429728 4:7147108-7147130 GGCTCCGAGAAATTCCACTGCGG - Intergenic
973143629 4:46798170-46798192 GACTCCTAGAAATTTCACTGAGG - Intronic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
975024412 4:69531195-69531217 GACCCTAAGAAACTTCACTGAGG - Intergenic
975974675 4:80081396-80081418 GCATGGGGGAAAGTTCACTGTGG + Intronic
979625682 4:122842643-122842665 CCTTAGGAGAAACTTCTCTGTGG + Intronic
982786201 4:159539736-159539758 GCCTCAGTGAAACATGACTGAGG - Intergenic
984727472 4:183035670-183035692 GGCATGAAGAAACTTCACTGGGG - Intergenic
985689772 5:1300687-1300709 GGCTCGGAGAAGCTCCACGGGGG + Intergenic
988258129 5:28848119-28848141 GCGTCCTAGAAACTTCACTGAGG - Intergenic
988711080 5:33775561-33775583 TCCTCAGAGAAACATCACTTTGG + Intronic
996908771 5:128632538-128632560 GACTCCTAGAAATTTCACTGAGG + Intronic
999717089 5:154369965-154369987 GCCTTGCAGAAACAGCACTGAGG - Intronic
1004199155 6:13532013-13532035 AGCTCGGGGAAACTTGACTGTGG - Intergenic
1004841566 6:19591912-19591934 ACCTCTGAGTAACTTCACAGTGG - Intergenic
1011721544 6:90162004-90162026 GGCTCAGAGAAGCTTCTCTGAGG - Intronic
1013581999 6:111544929-111544951 GCAATGGAGAAACTTGACTGGGG - Intergenic
1013993547 6:116280764-116280786 GCCTCAGAGAAATATCAGTGGGG + Intronic
1015618302 6:135102926-135102948 ACCTGGGAGAAAGGTCACTGAGG + Intronic
1019016106 6:168880646-168880668 GCTTCGGGGACACTGCACTGAGG - Intergenic
1019497323 7:1346598-1346620 GCCTGGGAGAAAGTCCCCTGTGG + Intergenic
1019728261 7:2615208-2615230 GCTTCGGACAAACTCCACTCAGG - Intergenic
1020897225 7:13955576-13955598 GCCTTGGAGAGACTTAACGGTGG + Intronic
1023607407 7:41942969-41942991 GACTTGGAGAAACATCTCTGTGG - Intergenic
1030938022 7:115610528-115610550 GCCTCAGAGAAATTTGCCTGTGG + Intergenic
1036527401 8:9547951-9547973 GACCCCTAGAAACTTCACTGGGG + Intergenic
1038728051 8:30099291-30099313 GGTTTGGAAAAACTTCACTGAGG + Intronic
1041119467 8:54571463-54571485 GACTCTGAGAAACCTGACTGTGG - Intergenic
1050067470 9:1775495-1775517 GACTCCTAGAAACCTCACTGAGG + Intergenic
1053352527 9:37422946-37422968 GTCTCGGAGAAAGTTCTCTGGGG + Intronic
1054843928 9:69772432-69772454 GACTCCTAGAAACTTCACTAAGG + Intergenic
1057975779 9:99604577-99604599 TCCTCTGAGAAGCTTCACTAGGG - Intergenic
1059729681 9:117044456-117044478 ACCTGGCAGAAACTTCACAGTGG + Intronic
1061401769 9:130372376-130372398 GGCACGGAGGAACTTCAGTGTGG + Intronic
1189983219 X:46530915-46530937 GCCTCCGAAAAACCCCACTGTGG + Intronic
1190255126 X:48756758-48756780 GACTCCTAGAAATTTCACTGAGG - Intergenic
1191095769 X:56671614-56671636 GACTCCTAGAAACTTTACTGAGG + Intergenic
1199371667 X:147056892-147056914 GCCTCCTAGAAATTTCACTTGGG + Intergenic