ID: 967410288

View in Genome Browser
Species Human (GRCh38)
Location 3:189160229-189160251
Sequence CAGGTTGACTAGAGATTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967410286_967410288 -10 Left 967410286 3:189160216-189160238 CCCAGTCAATTGGCAGGTTGACT 0: 1
1: 0
2: 1
3: 2
4: 89
Right 967410288 3:189160229-189160251 CAGGTTGACTAGAGATTTGATGG 0: 1
1: 0
2: 0
3: 14
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967410288 Original CRISPR CAGGTTGACTAGAGATTTGA TGG Intronic
900940454 1:5795321-5795343 CAGGCTGACCAGATATTTGCGGG - Intergenic
901348640 1:8570817-8570839 CACAATGACTAGAGATTTTAAGG + Intronic
903998718 1:27324965-27324987 CAGTTTGACAGGAGATTTGGCGG + Intronic
907946886 1:59143747-59143769 CAGGGTGATGAGAGATATGATGG + Intergenic
909585751 1:77285827-77285849 CAGTTAGACTTGAGCTTTGAGGG + Intronic
910048109 1:82942111-82942133 CAGATTGAAAAGATATTTGATGG - Intergenic
910990690 1:93052971-93052993 CAGTTTGACAGGAGATTTGGTGG + Intergenic
911842393 1:102700539-102700561 AAGAATGACTAGAAATTTGAGGG + Intergenic
913264541 1:117031498-117031520 CAGGGGGACTAGAGATGTAAGGG + Intronic
916636388 1:166673967-166673989 CTGGTTGACAATAGGTTTGAGGG - Intergenic
916699965 1:167282092-167282114 CAGTATGAATATAGATTTGAGGG - Intronic
917193184 1:172440599-172440621 GAGGTTGAGTAGCAATTTGAGGG - Intronic
918197791 1:182238652-182238674 CAGGCTAACAAGAGTTTTGAGGG - Intergenic
918317019 1:183330926-183330948 GAGGTTGAATGGAGATCTGAAGG - Intronic
918430425 1:184454494-184454516 CAGTTTGACATGAGATTTGGTGG - Intronic
919539297 1:198828701-198828723 ATGATTGACCAGAGATTTGATGG - Intergenic
921467449 1:215506250-215506272 CAGACTGTCAAGAGATTTGATGG - Intergenic
1065769262 10:29062002-29062024 CAGGTTAACTAGTCATTTGTTGG + Intergenic
1067398231 10:45944221-45944243 AAGCTTATCTAGAGATTTGAAGG - Intergenic
1067581118 10:47446663-47446685 GATGTTGACTAGAGATTTCAAGG - Intergenic
1067866550 10:49913306-49913328 AAGCTTATCTAGAGATTTGAAGG - Intronic
1068608440 10:59032004-59032026 CGGGATGACTAGGGATTTGGGGG + Intergenic
1073213260 10:101821597-101821619 TAGGTTGACAGGAGATTTGGGGG + Intergenic
1075159460 10:120010580-120010602 CAGTTTGACATGAGATTTGGTGG + Intergenic
1075374607 10:121968470-121968492 CAAGCTGAATAGAGATTTGTAGG - Intronic
1075548229 10:123372453-123372475 ATGGTTGAGTTGAGATTTGAAGG + Intergenic
1082622018 11:55435052-55435074 TAGGTTGACTAAATATTTGTTGG + Intergenic
1083013297 11:59424822-59424844 CTGCTTGACCAGTGATTTGAGGG - Intergenic
1086595053 11:88560664-88560686 CAGGTGGATTAGAGATCTGTTGG - Intronic
1087313240 11:96576255-96576277 CAGGCTTTCTAGATATTTGAAGG + Intergenic
1088810847 11:113391079-113391101 CCATTTGAGTAGAGATTTGAAGG + Intronic
1089066898 11:115668989-115669011 GAGTTAGAATAGAGATTTGAAGG + Intergenic
1093755485 12:22847291-22847313 CAGGTCTAATAGAGATTTGCTGG + Intergenic
1094296879 12:28916582-28916604 GAGGTTGACAAGAAAATTGAAGG + Intergenic
1095675815 12:44916932-44916954 CAGGTTGAAAGGATATTTGAAGG - Intronic
1096058178 12:48673110-48673132 CATTTTGACTAGTTATTTGAGGG - Intronic
1098082746 12:66807215-66807237 CAGTTTGACATGAGATTTGGTGG - Intergenic
1098895526 12:76056261-76056283 CAGATAGACTAGAACTTTGAAGG - Intronic
1105814689 13:24024031-24024053 CAGCTTCAATACAGATTTGAGGG + Intronic
1110745385 13:79047423-79047445 CAAGTAGACTGGAGATTTGGAGG + Intergenic
1111032116 13:82615163-82615185 CAGTTTTACTAGAGGTTTCATGG - Intergenic
1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG + Intronic
1115939509 14:38592407-38592429 CAGATTGACTAGACATTTCTAGG - Intergenic
1119448506 14:74687498-74687520 CTGTTTGGCTAGAGCTTTGATGG - Intronic
1120821108 14:88912654-88912676 CAGGTTGTGTAGAGCTTTGCAGG + Intergenic
1121625004 14:95377418-95377440 CAGTTTGACATGAGATTTGGTGG + Intergenic
1122595757 14:102889906-102889928 CAGGTAGACTTGACATTTGGTGG + Intronic
1122632746 14:103114473-103114495 CAGGAAGACTAGAGATAAGAAGG - Intergenic
1123158173 14:106250883-106250905 CAATTTGACATGAGATTTGAGGG - Intergenic
1123903059 15:24895530-24895552 CAGCTTGACCAGATATGTGATGG - Intronic
1125299941 15:38244707-38244729 CAGGTAAGCTAGAGAGTTGAGGG + Intergenic
1129021917 15:72527731-72527753 AAGGTTAACTTGAGTTTTGAAGG - Intronic
1129368565 15:75072199-75072221 CAGCTTCTCTAAAGATTTGAGGG + Intronic
1129922455 15:79331219-79331241 CAGTTTGACATGAGATTTGGTGG + Intronic
1130770397 15:86917941-86917963 GACTTTTACTAGAGATTTGAGGG - Intronic
1131404967 15:92156738-92156760 CAGGTTGAATAGAGATTCCATGG + Intronic
1131411792 15:92213606-92213628 CTGATGGACTTGAGATTTGAGGG - Intergenic
1131927632 15:97403163-97403185 CAGTTTGACATGAGATTTGGTGG + Intergenic
1133412396 16:5579537-5579559 CAGGTGGACTAGAGGATTGGGGG - Intergenic
1133501701 16:6372863-6372885 CGGGTGGAATGGAGATTTGATGG + Intronic
1137381864 16:48006837-48006859 CAAATTGACATGAGATTTGATGG + Intergenic
1139897526 16:70299432-70299454 CAGGTTGATTAGAGGCTGGATGG + Intronic
1143584851 17:7845967-7845989 CAGGGTGAGTGGATATTTGAAGG + Exonic
1144643900 17:16955556-16955578 AAGGTTGACTAATGATTGGAAGG + Intronic
1145204897 17:20978831-20978853 AAGGTTGACTAATGATGTGAAGG - Intergenic
1150618914 17:66793939-66793961 CAGGATGAGTGGAAATTTGAAGG - Intronic
1151070176 17:71200656-71200678 GACCTTGACAAGAGATTTGAAGG + Intergenic
1153380027 18:4428129-4428151 CAATTTGACATGAGATTTGAGGG - Intronic
1155080329 18:22403502-22403524 GAGGCTGAGTAGAGATTAGAAGG - Intergenic
1158756020 18:60326554-60326576 AAGGATGACAAGAGACTTGACGG - Intergenic
1161633209 19:5369907-5369929 CAGGTTGTGAATAGATTTGAAGG - Intergenic
925314133 2:2908269-2908291 CTGGTTGACCACAGATATGAAGG + Intergenic
925639074 2:5970074-5970096 CAGATTGATTAGAAATTAGAAGG - Intergenic
926951152 2:18245040-18245062 CAGGAGGAGTAGAGATTGGAGGG - Intronic
927347670 2:22065437-22065459 CAGTTTGACATGAGATTTGGTGG - Intergenic
930621566 2:53649521-53649543 CTGGTTGAGCAGAGAATTGAGGG - Intronic
931800752 2:65755818-65755840 CAATTTGACAGGAGATTTGATGG + Intergenic
931912654 2:66918537-66918559 CAAGTTGACATGAGATTTGGTGG - Intergenic
931966097 2:67536647-67536669 CAATTTGACATGAGATTTGATGG - Intergenic
933819920 2:86101553-86101575 CAGGTGGACTCTAGATTTGTGGG - Intronic
933989568 2:87624571-87624593 CGGTTTGACAAGAGATTTGGTGG + Intergenic
936304275 2:111326255-111326277 CGGTTTGACAAGAGATTTGGTGG - Intergenic
938976498 2:136483266-136483288 GAGATTGACTATAGACTTGAAGG + Intergenic
939742694 2:145929337-145929359 CAGTTTGACATGAGATTTGGTGG - Intergenic
939885821 2:147680791-147680813 GAGGTTGTCTAGAGATTGGGCGG + Intergenic
945253270 2:207782548-207782570 CAGGATGGCTTGATATTTGAAGG + Intergenic
1169165251 20:3417237-3417259 CAGTTTGACATGAGATTTGGTGG + Intergenic
1169737892 20:8856717-8856739 CAGGATGGCTAGTGATTGGAAGG + Intronic
1169837007 20:9891279-9891301 CAGTTTGACATGAGATTTGAAGG + Intergenic
1171299998 20:24051853-24051875 CAATTTGACTTGAGATTTGGTGG + Intergenic
1172024748 20:31940657-31940679 CAGATTTACTGGAGACTTGATGG + Intronic
1173590717 20:44222639-44222661 CAGTTTGACCTGAGATTTGGAGG - Intergenic
1174477339 20:50805333-50805355 CAGATTGGCCAGAGACTTGAAGG + Intronic
1175621315 20:60449953-60449975 CAGCTTGACTAGACATTAGAGGG + Intergenic
1182974161 22:34606904-34606926 CAGGGAGACTAGAGAGATGATGG - Intergenic
951344859 3:21535862-21535884 CAGGGTGACTAGCGATGGGATGG - Intronic
958067387 3:88560859-88560881 CATTTTGACTTGAGATTTAATGG + Intergenic
958263996 3:91415899-91415921 CAAGTTGACTGGAATTTTGAAGG - Intergenic
958486684 3:94720645-94720667 CAGGTTGAGTAGAGCTTTGGAGG + Intergenic
959360156 3:105378889-105378911 CTGCTTGAGTAGTGATTTGATGG + Intronic
964246720 3:154662343-154662365 CAGGTTGTCTAGAGCCTTGGAGG + Intergenic
964394716 3:156233511-156233533 CAGGTTGAGTAGAGCCTTGGAGG + Intronic
965011382 3:163096628-163096650 CAGGGTTCCTAGGGATTTGAGGG - Intergenic
966344622 3:178964859-178964881 CAGGCTGAGTAGAGACGTGAGGG - Intergenic
966407050 3:179608791-179608813 CAAGTTGACTGGAGGTCTGAAGG - Intronic
966530157 3:180968769-180968791 TTGGATGACTAAAGATTTGAGGG + Intronic
967410288 3:189160229-189160251 CAGGTTGACTAGAGATTTGATGG + Intronic
967413418 3:189190489-189190511 GAGGCTGCCCAGAGATTTGAGGG - Intronic
967737379 3:192967124-192967146 CAGGTTTATCAGAGATTAGATGG + Intergenic
968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG + Intronic
968682225 4:1929098-1929120 CAGGTTGTCTAGAGAGGTGGTGG + Intronic
969999114 4:11345889-11345911 CAGGTTGATTAGAGATGGGAAGG - Intergenic
970236441 4:13963410-13963432 CATGTTGACTATATATTTGTAGG + Intergenic
970279327 4:14436700-14436722 CAGGTGGACAAGAGAATGGAAGG + Intergenic
972194139 4:36632254-36632276 CAAGTTTACTGGAGATCTGATGG + Intergenic
973068523 4:45827471-45827493 CAGGGTGACTAGAGCTTAGCTGG - Intergenic
974947997 4:68551892-68551914 CAGGTTCTATGGAGATTTGATGG - Exonic
974957080 4:68655163-68655185 CAGGTTCTATGGAGATTTGATGG - Exonic
974970963 4:68826407-68826429 CAGGTTCTTTGGAGATTTGATGG + Exonic
974978387 4:68921293-68921315 CAGGTTCTGTGGAGATTTGATGG - Intergenic
974984821 4:69009984-69010006 CAGGTTCTTTGGAGATTTGATGG - Intronic
974986854 4:69038224-69038246 CAGGTTCTGTGGAGATTTGATGG + Intronic
974992208 4:69107172-69107194 CAGGTTCTGTGGAGATTTGATGG + Exonic
974999585 4:69205548-69205570 CAGGTTCTGTGGAGATTTGACGG - Exonic
975006189 4:69289662-69289684 CAGGTTCTGTGGAGATTTGATGG + Exonic
975014606 4:69398604-69398626 CAGGTTCTGTGGAGATTTGATGG + Intronic
975015855 4:69418015-69418037 CAGGTTCTGTGGAGATTTGATGG + Intronic
975020881 4:69486677-69486699 CAGGTTCTGTGGAGATTTGATGG - Exonic
975643433 4:76523762-76523784 CCGGTTGAACAGAGTTTTGAAGG + Intronic
976045288 4:80939800-80939822 CAGCTTAACTAGAGATTTTGAGG + Intronic
976883454 4:89958799-89958821 AAGGTAGAGTAGAGAATTGAAGG - Intergenic
977771985 4:100870731-100870753 ATGGCTGACTAGAGATTTCAGGG - Intronic
979234946 4:118389082-118389104 CATATTGACAAGAGATTTTAGGG + Intergenic
980726775 4:136771931-136771953 CAGGTTTACAACAGATATGAGGG - Intergenic
981158451 4:141468701-141468723 AATGTTGACTAGCTATTTGAAGG + Intergenic
983948278 4:173610363-173610385 CAGGATGACTAGGAATTTGGGGG - Intergenic
983970233 4:173862682-173862704 CAGTTTGACTAAAGGTTTAAAGG + Intergenic
984632667 4:182076990-182077012 CAAGTTGAATTGAGTTTTGAGGG - Intergenic
987280052 5:16404265-16404287 CAAGTTGACTATAGAATTAAAGG - Intergenic
988924377 5:35974532-35974554 CAAGTTGAATAGGGATGTGATGG - Intronic
990368758 5:55095662-55095684 CAGGTTGAGTAGAGGGTAGAGGG - Intergenic
991770000 5:70031445-70031467 CAGTTTGACTGGAGATGAGAAGG + Intronic
991849295 5:70906864-70906886 CAGTTTGACTGGAGATGAGAAGG + Intronic
996126308 5:119728827-119728849 CAATTTGACATGAGATTTGATGG - Intergenic
998281769 5:140816695-140816717 CAGGCTGGCTAGAGATTCTAGGG + Intronic
1001602349 5:172937334-172937356 CAAGTTCACTAGAAATTGGAGGG + Intronic
1001632013 5:173182461-173182483 TAGGAAGACCAGAGATTTGATGG - Intergenic
1002872254 6:1177534-1177556 CACATTAACCAGAGATTTGAGGG + Intergenic
1003697370 6:8423523-8423545 CACTTTGACTAGATATTTAATGG + Intronic
1008714959 6:54277080-54277102 CATGTTGGCTAGAGATTTTGAGG - Intergenic
1008991437 6:57607077-57607099 CAAGTTGACTGGAATTTTGAAGG + Intronic
1009179957 6:60505314-60505336 CAAGTTGACTGGAATTTTGAAGG + Intergenic
1009580881 6:65532299-65532321 CAGATTGAATAGAAATATGAAGG - Intronic
1012039603 6:94186827-94186849 CAGTTTGACATGAGATTTGGTGG + Intergenic
1012761034 6:103301371-103301393 CAGGTTGATTGCAGATTTAAAGG - Intergenic
1014229802 6:118890705-118890727 AATATAGACTAGAGATTTGATGG - Intronic
1014976841 6:127897159-127897181 CAGATAGACTACAGATCTGAAGG + Intronic
1017628337 6:156370688-156370710 CAGCCTGGCTAGAGATGTGATGG - Intergenic
1018150634 6:160934145-160934167 AAGGTTATTTAGAGATTTGAAGG - Intergenic
1020416480 7:7951634-7951656 CAGTTTGACATGAGATTTGGTGG + Intronic
1026777489 7:73239769-73239791 CAGGATGGCTTGAGATATGATGG - Intergenic
1027018342 7:74793141-74793163 CAGGATGGCTTGAGATATGATGG - Intergenic
1027069686 7:75152777-75152799 CAGGATGGCTTGAGATATGATGG + Intergenic
1031203367 7:118720836-118720858 CAGGTTGACTATGGGTGTGAAGG - Intergenic
1032107965 7:129050755-129050777 CAGGCTGACTAGAGAACTCAAGG + Intronic
1033145287 7:138865891-138865913 CAGGTTGGCTGGAGAAGTGAAGG + Intronic
1035162076 7:156958499-156958521 CAGCTTAAGTTGAGATTTGACGG + Intronic
1036383098 8:8252278-8252300 CCGTTTGACATGAGATTTGATGG - Intergenic
1038377095 8:27051406-27051428 CCGTTTGACTAGAGATTTTAAGG - Intergenic
1038785368 8:30609703-30609725 CAGTTTGACATGAGATTTGATGG - Intronic
1042041715 8:64598740-64598762 CTCGTTGAGTAGAAATTTGAGGG - Intronic
1042978326 8:74496429-74496451 CAGGTTGATTACATATTTTAGGG + Intergenic
1043581050 8:81715441-81715463 TAGGTTGACTTGCCATTTGAGGG - Intronic
1045145504 8:99339562-99339584 CAGTTTGACATGAGATTTGGTGG + Intronic
1045832341 8:106477978-106478000 CATGTTGACTGGGGATTGGATGG + Intronic
1051422173 9:16900120-16900142 GAGGTTGACTATTGGTTTGAGGG + Intergenic
1052091242 9:24330163-24330185 CAGTTTGACTTGAGATATGAAGG - Intergenic
1053453750 9:38214769-38214791 CAGGTTTCCTGGAGATCTGAAGG + Intergenic
1053545517 9:39019123-39019145 CAGATTTATTAGAGATTTGGAGG - Intergenic
1054748363 9:68879089-68879111 AAGATTGACAAGATATTTGATGG + Intronic
1055527682 9:77151764-77151786 CAGTTTGACCAAAGATTTGAAGG + Intergenic
1056310552 9:85336806-85336828 CAGGTTGTCTAGAGCTTTCTAGG - Intergenic
1058380238 9:104369928-104369950 CATGTTGCCCAGAGACTTGATGG + Intergenic
1061658026 9:132107724-132107746 CAGGCTGCTTAGAGATTTGAGGG - Intergenic
1186220622 X:7345507-7345529 CAAGTTTACTGGAGATCTGAAGG - Intronic
1187960112 X:24560064-24560086 CAGGCTGACTATACATTTGCAGG - Intronic
1188055388 X:25535191-25535213 CAGGTGGACTGGAGATTTGTTGG - Intergenic
1197524075 X:127539790-127539812 CAATTTGACATGAGATTTGATGG + Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200164549 X:154027144-154027166 CAGGTTGACAGGAGGTTGGAGGG - Intronic
1201479236 Y:14419790-14419812 AAAGTTAACTAGACATTTGAAGG - Intergenic