ID: 967411849

View in Genome Browser
Species Human (GRCh38)
Location 3:189174188-189174210
Sequence GCTTGCAGAGCAGCAGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 312}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967411847_967411849 -1 Left 967411847 3:189174166-189174188 CCGAGAATTCATTTACTCCAGAG 0: 1
1: 0
2: 1
3: 15
4: 214
Right 967411849 3:189174188-189174210 GCTTGCAGAGCAGCAGCCACAGG 0: 1
1: 0
2: 2
3: 26
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967411849 Original CRISPR GCTTGCAGAGCAGCAGCCAC AGG Intronic
900207179 1:1436539-1436561 GCTTTCAGAGGAGCAGCCTGAGG - Intronic
901156816 1:7145771-7145793 GCTTGCAGCCTAGAAGCCACAGG - Intronic
901705752 1:11071729-11071751 GCATGCTGAGCAGCAGCAAGTGG - Intronic
901777425 1:11569930-11569952 GCTTGCTGAGCTGCTGCCCCTGG + Intergenic
903288499 1:22292074-22292096 GCCTTCAGAGCAGCGGCCTCGGG - Intergenic
903543998 1:24112255-24112277 GCCTGCTGGGCAGCAGCGACAGG + Intergenic
903590684 1:24453572-24453594 GTTTGCAGAGCTGTAGCCGCTGG + Intronic
904607584 1:31706429-31706451 GCTCCCAGAGAAACAGCCACTGG + Intergenic
904624426 1:31794050-31794072 GCGTGCAGTTCAGCAGCAACAGG - Intronic
904657887 1:32062900-32062922 GGTCGAAGAGCAGCAGCCAAGGG - Intergenic
905522782 1:38613333-38613355 GTTTGCACAGTAACAGCCACAGG - Intergenic
905892312 1:41525139-41525161 TCCTCCAGAGCAGCAGACACTGG + Intronic
908556405 1:65261044-65261066 GCTTGCTGAGCATGAGTCACTGG + Intronic
915310078 1:155002246-155002268 GCGGGCAGAGCAGCAGCAAAGGG + Intergenic
916244662 1:162675331-162675353 GGTGGCACAGCAGCAACCACAGG + Intronic
916599353 1:166276812-166276834 GCTAACAGAGCAGCAGCTACGGG - Intergenic
917739170 1:177946419-177946441 TCTTGCTGGGCAGCAGCCACAGG - Exonic
918377048 1:183919830-183919852 GCATTCAGTACAGCAGCCACTGG + Intronic
920326552 1:205169533-205169555 GCTATCTGAGCAGCAGTCACTGG - Exonic
920550774 1:206859033-206859055 GCCTGCAGAGCAAGAGACACTGG - Intergenic
921659026 1:217776908-217776930 GCTTTCAAAACAGAAGCCACAGG + Intronic
921737426 1:218643891-218643913 GCTTGCTGAGCTGCAGACAATGG - Intergenic
922924877 1:229340551-229340573 GCTAGCAGATCAGTACCCACAGG + Intronic
922974452 1:229772099-229772121 TCTGGCTGAGGAGCAGCCACAGG + Intergenic
923566999 1:235083744-235083766 GGGAGCAGAGCAGCAGCAACAGG + Intergenic
924384796 1:243490762-243490784 GCCTGCAGAGCAGCAGCTGTGGG + Intronic
1063389497 10:5640167-5640189 GCCAGCAGAGCAGCAGTCCCAGG + Exonic
1064105071 10:12493842-12493864 GATTGCAGCTGAGCAGCCACAGG + Intronic
1065157642 10:22886478-22886500 GGCTGCAGAGCAGCAGATACTGG - Intergenic
1066389080 10:34964362-34964384 GCAGGCAGAGCGGCAGCCGCAGG + Intergenic
1067370680 10:45678947-45678969 GGCTGCACAGCAGCAGCCATGGG - Intergenic
1069785174 10:70983232-70983254 GCCTGCAGACCAACAGACACTGG - Intergenic
1070136316 10:73697604-73697626 GGCTGCACAGCAGCAGCCATGGG + Exonic
1070809500 10:79290525-79290547 CCTCACAGAGCAGCAGCCAGGGG + Intronic
1071524159 10:86348527-86348549 CCCTGCAGGCCAGCAGCCACAGG + Intronic
1075616284 10:123892527-123892549 GCCTGGAGAGCAGAAGCCGCAGG - Intronic
1076214619 10:128682954-128682976 GCCTGCACAGCATCAGCCAGTGG - Intergenic
1076402691 10:130194199-130194221 GCCTGCAGGGCAGCAGGCATTGG - Intergenic
1076764557 10:132625804-132625826 CCTTGCAGAGAAGCAGCCTCAGG - Intronic
1076799659 10:132814732-132814754 GGTTGCAGGGCAGCATCCCCCGG - Exonic
1077364969 11:2157988-2158010 ACTTGCAGGGCAGCTGGCACTGG - Intronic
1079005433 11:16788600-16788622 GCTTGCAGTGCAGAGGCCTCAGG - Exonic
1081858798 11:46320376-46320398 GCCGGCAGAGCAGCGGCCCCGGG + Exonic
1081908110 11:46681995-46682017 GCTGGCAGAGCCGCTGCCTCTGG + Intronic
1083741998 11:64716133-64716155 GCTGGGAGAGCAGCAGACAGAGG - Intronic
1084430354 11:69107368-69107390 GCTCTTAGTGCAGCAGCCACTGG - Intergenic
1084653941 11:70504477-70504499 GACTGCAGAGCAGCTGGCACGGG - Intronic
1085056105 11:73404962-73404984 GATTGCCCAGCAGCAGCCTCCGG - Intronic
1085161773 11:74354391-74354413 GCTTCCTCAGCAGCATCCACGGG - Intronic
1087254099 11:95935664-95935686 TCTTTCAGAGCAGCCACCACTGG + Intergenic
1087765123 11:102143101-102143123 GGTTGCAGAGAGGCAGCCATAGG - Intronic
1089630113 11:119779185-119779207 CCTTCCAGAGCAGGAGCCCCTGG - Intergenic
1090375962 11:126289686-126289708 GCTGGCAGAGCAACTGGCACAGG - Exonic
1090463168 11:126909976-126909998 GGTTGCAGAGCAGCAGTTCCAGG + Intronic
1090879756 11:130823369-130823391 GCTTACTGAGGAGCAGCCCCAGG + Intergenic
1091846150 12:3657665-3657687 GCTTCCAGAGAATCAGCCCCAGG + Intronic
1092002793 12:5045272-5045294 ACTGGCAGAGCAGCAGCCAGGGG + Exonic
1092170536 12:6371351-6371373 GCGGGCAGAGCAGCAGTCATTGG - Intronic
1096773849 12:53952431-53952453 GCGTGAGGAGCAGCGGCCACAGG - Intergenic
1098929291 12:76391907-76391929 GGTTACAGAGCAGAAGCCAAGGG + Intronic
1101193474 12:102358801-102358823 GCTTGCAGACCTGCATCCTCTGG - Intergenic
1101412662 12:104482284-104482306 GGTGGCAGAGCAGCCTCCACTGG - Intronic
1101890847 12:108713843-108713865 GCTGTCAAAGCAGCACCCACAGG - Intronic
1102004397 12:109580041-109580063 TCTTCTAGAGCAGCAGCCATTGG + Intronic
1102080510 12:110094232-110094254 TCCTGAAGAGCAGCATCCACAGG - Intergenic
1102452143 12:113049867-113049889 GCTCGCACAGCAGAAGCCCCTGG - Intergenic
1102546598 12:113661702-113661724 GCTTGCATACCACCAGCAACGGG + Intergenic
1102698428 12:114817908-114817930 GCTTGCAGAACACCTGCCTCTGG - Intergenic
1103415823 12:120741034-120741056 CCCTGCAGAGCAGCAGCTCCAGG - Intergenic
1103462227 12:121114059-121114081 TCCTGAAGAGCAGCATCCACAGG + Intergenic
1103638346 12:122327857-122327879 GCTTAGAAAGCAGCAGCCAGTGG - Intronic
1105816883 13:24044139-24044161 GCTTGCAGCACAGCAGCCCCGGG - Intronic
1107470558 13:40687702-40687724 GCGGGCACAGCATCAGCCACAGG - Intergenic
1108478063 13:50841042-50841064 GCTTCCAGAGCAGAGGACACGGG + Intronic
1109514130 13:63419282-63419304 GATTCCAGAGCTGTAGCCACAGG - Intergenic
1111966488 13:94867000-94867022 GCTTGCTTAGCATCAGCCATGGG - Intergenic
1113840351 13:113355790-113355812 CCGTGCAGAGCAGCAGCAAAGGG + Intronic
1115640011 14:35329382-35329404 GGGTGCAGAGCAGCAGTAACTGG + Intergenic
1115750922 14:36489005-36489027 GCCTGCTGATGAGCAGCCACAGG + Intronic
1119421213 14:74509044-74509066 GCCTGCAGAGCTGGACCCACGGG + Intronic
1120838818 14:89064900-89064922 GCCTGGAGAGGAGCAGCCAGAGG + Intergenic
1121775682 14:96589063-96589085 GCTTGCCTAGAAGCAGCCAGGGG - Intergenic
1122082929 14:99279148-99279170 GCTCTCACTGCAGCAGCCACAGG + Intergenic
1122200282 14:100118503-100118525 GCTTGCAGAATAGCAGCAAAGGG + Intronic
1122814113 14:104303916-104303938 GCTTGCAGAGCAGGGGTCTCCGG - Intergenic
1123165301 14:106320076-106320098 GGATGCAGAGGATCAGCCACAGG + Intergenic
1124382212 15:29176597-29176619 ACATGCAGGGCAGGAGCCACGGG + Intronic
1125386237 15:39140042-39140064 GCTGGCATAGGAGCAGCCCCAGG + Intergenic
1126535401 15:49756723-49756745 GCCAGCAGTCCAGCAGCCACTGG + Intergenic
1129525003 15:76208257-76208279 AGTTGCAGAGGAGCAGCCAGAGG + Intronic
1129650752 15:77486664-77486686 ACTTGGAGAGCAGCAGGCTCTGG - Intergenic
1130375833 15:83327724-83327746 CCTTGCAGAGAGCCAGCCACTGG + Intergenic
1132394497 15:101462933-101462955 GCTTGCAAGGCAGCAGCCCCAGG + Intronic
1132394693 15:101464158-101464180 GCTTGCAAGGCAGCAGCCCCAGG - Intronic
1133011442 16:2914210-2914232 GCTTGCTGGGCAGGAGCCCCGGG - Exonic
1133065304 16:3202189-3202211 CCTTCCAGACTAGCAGCCACAGG - Intergenic
1134366362 16:13582885-13582907 GGTTTCTGAGCAGCAGCAACTGG - Intergenic
1134786889 16:16952697-16952719 GCTTGTTGGGCAGCAGCCGCGGG + Intergenic
1134847105 16:17449329-17449351 GCATGGAGAACAGCAGCCCCTGG + Intronic
1135304517 16:21356563-21356585 GCTGGCAAAGCAGAGGCCACAGG - Intergenic
1135716753 16:24777129-24777151 GCAGCCACAGCAGCAGCCACAGG + Exonic
1136101034 16:27996179-27996201 GCTTCCACACCATCAGCCACAGG + Intronic
1136301260 16:29335693-29335715 GCTGGCAAAGCAGAGGCCACAGG - Intergenic
1136448841 16:30340798-30340820 GCTTGCTGAGCTGCACCAACAGG - Intergenic
1138114232 16:54347715-54347737 GCTTGCAGTGCAGAAGCAGCAGG + Intergenic
1140264048 16:73405057-73405079 CCTTGAAGAGCAACAGCCCCAGG - Intergenic
1141281298 16:82631948-82631970 GGTTGCCAAGTAGCAGCCACAGG + Intronic
1141552783 16:84817372-84817394 GCTTGCAGAGCAGTGGTCTCTGG + Intergenic
1142062958 16:88042429-88042451 GCTGGCAAAGCAGAGGCCACAGG - Intronic
1142200141 16:88757263-88757285 GCTGGCAGCGCAGCAGCACCTGG + Intronic
1142745024 17:1952060-1952082 GCTAGGAGAGCAGCAGCTTCTGG - Intronic
1144044880 17:11446435-11446457 GCTTGAAGAGGGGCAGCCAGAGG - Intronic
1144338912 17:14297246-14297268 GCTTGGCCAGCAGCAGCCGCGGG + Intergenic
1144393036 17:14813815-14813837 CCATGCACAGCAGCAGCCGCGGG + Intergenic
1144447033 17:15341100-15341122 GCCTTCAGATCTGCAGCCACGGG - Intronic
1144777963 17:17794295-17794317 CCTTGGAGAGCAGCAGCTGCTGG - Exonic
1144848226 17:18231018-18231040 GCACGCAGCGCAGCACCCACAGG - Intronic
1145207506 17:20992484-20992506 GCTTGCAGAGCAGAAGGACCAGG + Intergenic
1145226395 17:21132094-21132116 ATTTGCAGATCAGCAGCCTCTGG + Intronic
1146167535 17:30601221-30601243 GCTCGGGGAGCAGCAGCCCCTGG + Intergenic
1147378162 17:40035270-40035292 CCGTGCAGCGCAGCAGCCAGTGG + Exonic
1148860061 17:50600056-50600078 GGTGGCAGAGCCGCAGCCCCAGG - Intronic
1150221299 17:63497219-63497241 CCAGGAAGAGCAGCAGCCACTGG - Intronic
1151680593 17:75620752-75620774 GCGGGCAGAGGGGCAGCCACAGG - Intergenic
1152109972 17:78352728-78352750 GCTTTCTGAGCAGCCGCCCCTGG + Intergenic
1152334719 17:79694127-79694149 CCTTGCATGGCAGCAGTCACAGG + Intergenic
1152870319 17:82750647-82750669 GCTGGTAGAGCAGCAGCCGCTGG - Exonic
1153549814 18:6250480-6250502 GCTGGCAGAGCATCAGCTAGGGG + Intronic
1154339121 18:13488672-13488694 TCTTGCAGAGCAGGAGGCTCAGG - Intronic
1155500998 18:26486655-26486677 ACCTGGAGAGCAGCAGTCACAGG - Intronic
1156472001 18:37383241-37383263 CCAGGCAGAGCAGCGGCCACTGG + Intronic
1157531582 18:48425482-48425504 GATTTCAGCACAGCAGCCACTGG - Intergenic
1157624878 18:49042802-49042824 TCTTGCAGGGAAACAGCCACTGG - Exonic
1158538545 18:58330716-58330738 GCTTTCAGAGAAGGAGACACTGG - Exonic
1158601784 18:58862848-58862870 GCTTTCAGAGAAAAAGCCACTGG - Exonic
1158702569 18:59761864-59761886 GGTTGTAGAGCAGCACCCGCAGG - Intergenic
1159404015 18:67976947-67976969 GCTTGCAGAAATGAAGCCACCGG - Intergenic
1160157662 18:76445909-76445931 TCTTTCAGAGCAGCAGCTCCTGG + Intronic
1160455587 18:78996807-78996829 GCTTCCAGCGCAGCAGACAGAGG - Intronic
1161302137 19:3547877-3547899 GCTTCCAGAGCAGCAGGGGCTGG + Exonic
1161329878 19:3681593-3681615 GCTTGCAGAGCACCAGCCCGCGG - Intronic
1161340331 19:3738435-3738457 GCTTCCAGAGCTGCTGCCAAGGG - Intronic
1161561765 19:4977302-4977324 TCTTGAGGTGCAGCAGCCACTGG - Intronic
1161840112 19:6674961-6674983 GCTTGGGGAGCAGCAGCCTTGGG - Intergenic
1161939731 19:7394997-7395019 GCTCGGGGAGCAGCAGCCCCAGG + Intronic
1162330722 19:10027667-10027689 CCTTGCAGAGATGCAGCCTCTGG - Intergenic
1162463867 19:10829554-10829576 GCTGGAGGGGCAGCAGCCACAGG + Intronic
1165064137 19:33219334-33219356 GCATGCACCGCAGCGGCCACGGG - Intronic
1165352697 19:35284797-35284819 ACTTGCAGAGCTGCAACCCCAGG + Exonic
1166976845 19:46609800-46609822 GGTTTCAGAACAGCAGCCAGTGG - Exonic
1168681203 19:58317208-58317230 GCTTCAAGGACAGCAGCCACAGG - Intergenic
925380463 2:3421873-3421895 TCTTGCAGAGCTGCAGAAACTGG + Exonic
932068210 2:68589253-68589275 CTTTGCAGAGGAGAAGCCACAGG + Intronic
932607655 2:73175773-73175795 GCTTGCAGAGCCGGGGCCCCGGG + Intergenic
935062603 2:99621536-99621558 GGTTGCAGAGCAACAGTGACAGG - Intronic
935287310 2:101576512-101576534 CCTTGCAGATCACCAGCTACAGG - Intergenic
935672543 2:105568171-105568193 GTTTACAGAGCAGCGGACACGGG + Intergenic
936255716 2:110908965-110908987 GAATTCAGAGCAGCAGGCACAGG + Intronic
938257334 2:129869399-129869421 CCACGCAGAGCAGCAGCCACGGG - Intergenic
938555996 2:132424820-132424842 TCTGGCAGAGCAGCTGACACTGG + Intronic
938804918 2:134797109-134797131 GCTAGCAGATCAGCACCCTCAGG + Intergenic
938843101 2:135181781-135181803 ACCTGGAGAGCAGCAGCCCCAGG - Intronic
943339745 2:186665672-186665694 GCTTGAAAAGAAGCAGCCAATGG + Intronic
947073954 2:226320758-226320780 GCTAGCAGAGCACCAGCTAGCGG - Intergenic
947819961 2:233062660-233062682 GTTTGCAGCCCAGCAGCCTCAGG - Intronic
947827336 2:233115279-233115301 GCAGGCAGAGCAGGAGCCCCGGG - Intronic
948882669 2:240868418-240868440 GCTTGCAAAGCAGCTGCCAGAGG - Intergenic
948992666 2:241562694-241562716 GCATGCTGAGCAGCTGGCACAGG + Intronic
1168880783 20:1204494-1204516 GCTTCCTGAGCAGCAACCACAGG - Intronic
1169123447 20:3110932-3110954 GCCTGCAGTGCACCTGCCACTGG + Intronic
1170029048 20:11925136-11925158 GCTTGCAGAGCAGGAGCAGGAGG - Exonic
1171398911 20:24859109-24859131 GCTGGCAGTGCACCAACCACAGG + Intergenic
1171457859 20:25282099-25282121 GGTTGCACAGCAGCAGCCACCGG - Exonic
1172767038 20:37356458-37356480 GCCTGGAGAGAAGCAGGCACTGG + Intronic
1172997702 20:39083349-39083371 CCCTGCAGAGCAGGAGCCAGAGG + Intergenic
1173405069 20:42757362-42757384 GGTAGCAGGGCACCAGCCACAGG - Intronic
1173709959 20:45146416-45146438 TATTGCAGAGCAGAAGTCACTGG - Intergenic
1173862428 20:46292893-46292915 TCTAGAAGAGCACCAGCCACTGG + Intronic
1173918293 20:46725741-46725763 GCTGGAAGAGCACCAGCCCCAGG - Exonic
1174358600 20:50014458-50014480 GCCTGGAGACCAGCAGCCACTGG - Intergenic
1175050167 20:56147937-56147959 GGGTGCAAAGCATCAGCCACAGG + Intergenic
1175382603 20:58574173-58574195 GCCTCCAGAGCAGCCTCCACCGG - Intergenic
1176597091 21:8757610-8757632 GCTCCCAGAGCAGCAGCCTAGGG + Intergenic
1176642907 21:9323555-9323577 GCTCCCAGAGCAGCAGCCTAGGG + Intergenic
1179036425 21:37762458-37762480 GCTGGCTGGGCAGGAGCCACAGG + Intronic
1179568709 21:42265222-42265244 GCATCCAGTGCAGCAGCCCCGGG + Intronic
1180351931 22:11812958-11812980 GCTCCCAGAGCAGCAGCCGAGGG + Intergenic
1180370028 22:11975644-11975666 GCTCCCAGAGCAGCAGCCTAGGG - Intergenic
1180386279 22:12179112-12179134 GCTCCCAGAGCAGCAGCCTAGGG - Intergenic
1180421349 22:12817222-12817244 GCTCCCAGAGCAGCAGCCTAGGG - Intergenic
1181983469 22:26782840-26782862 GCTTGCAGAGATTCAGCCACTGG + Intergenic
1182291968 22:29287105-29287127 GCCAACAGAGCAGCAGCTACGGG + Exonic
1182466484 22:30520021-30520043 GCCTGCTGAGCACCAGCCATAGG + Intergenic
1183299934 22:37053853-37053875 GTTAGCAGAGCTGCAGCCAGGGG + Intronic
1184418246 22:44364376-44364398 GCTTGAACCCCAGCAGCCACGGG - Intergenic
1185148606 22:49152129-49152151 GCTTGGAGGGAGGCAGCCACAGG + Intergenic
949557898 3:5173666-5173688 GGCTGGAGTGCAGCAGCCACTGG - Intronic
950423061 3:12909937-12909959 ACTGGCAGAGCATCAGCCACTGG + Intronic
950549915 3:13660061-13660083 GATTGGAGAGAAGCAGCCTCAGG + Intergenic
950902883 3:16513275-16513297 GCTGCCAGAGCAGCACCCCCTGG - Intronic
950964752 3:17138481-17138503 TCTTGCAGAGCTGCTGCCCCAGG + Intergenic
952800541 3:37286825-37286847 GCTTCACAAGCAGCAGCCACAGG - Intronic
955405536 3:58623447-58623469 GCCTCTAGAGCAGCAGCAACAGG + Intronic
955805747 3:62732264-62732286 GTTTGCAGTACAGCAGTCACAGG - Intronic
956174106 3:66457105-66457127 GCTGGCAGAACAGCAGGCAGTGG - Intronic
956483064 3:69692067-69692089 GCTTGAAGATCAGCAACAACAGG + Intergenic
956536235 3:70280149-70280171 GATTGGAGTGCAGCAGTCACAGG - Intergenic
956620614 3:71217994-71218016 GCTTGCAGAGGTGGAGCCAGGGG - Intronic
959675235 3:109027750-109027772 ACTGGCAGAACAGCAGCCACAGG - Exonic
960096756 3:113696674-113696696 GCTTGCTGAGCTGCGGCCGCGGG - Intergenic
960378392 3:116930789-116930811 GCATGCAGAGCACGGGCCACAGG + Intronic
961325914 3:126109273-126109295 GCCAGAAGCGCAGCAGCCACGGG - Intronic
961461149 3:127051153-127051175 GCTTGCAGATCCGCAGCAAGGGG + Intergenic
961561585 3:127734014-127734036 CCTTGCAGAGCAGGAGGCCCAGG + Intronic
962824927 3:139092106-139092128 GCTTGCTGACCAACAGCAACAGG - Intronic
967411849 3:189174188-189174210 GCTTGCAGAGCAGCAGCCACAGG + Intronic
1202743978 3_GL000221v1_random:81458-81480 GCTCCCAGAGCAGCAGCCTAGGG - Intergenic
968488391 4:876326-876348 GGGGGCAGAGCAGCAGCCACCGG + Intronic
968565126 4:1308137-1308159 GTTTGCAGCCCAGGAGCCACAGG - Intronic
969260044 4:6027628-6027650 GCATGCAGAGCAGGAGGAACTGG - Intronic
969267602 4:6074883-6074905 GCTTGCAGCCCAGAAGCCACAGG + Intronic
969549299 4:7853769-7853791 CCTTGAAGAGCAACAGCCATGGG - Intronic
969868634 4:10091587-10091609 GCTTGCTGAGCAGCTGCCCAAGG - Intronic
970663965 4:18316179-18316201 GTTTGTGGGGCAGCAGCCACAGG + Intergenic
973360392 4:49159832-49159854 GCTCCCAGAGCAGCAGCCTAGGG + Intergenic
975544216 4:75545384-75545406 GTTTGCAGAGCAGGAGCCTGAGG - Intronic
979883445 4:125992159-125992181 GCTTGGTGTGCAGCAGCCAGGGG + Intergenic
980995526 4:139776520-139776542 AAGTGCAGAGCTGCAGCCACTGG + Intronic
981355476 4:143784789-143784811 GCTGCCAGAGCAGCAGGCTCTGG - Intergenic
981938377 4:150257065-150257087 GCTTGCAGGGAAGCAGCCGCTGG - Exonic
982267110 4:153548143-153548165 GCTTGCAGAGAAGTTGCCTCCGG - Intronic
985309057 4:188577484-188577506 GCTTTCACAGAAGCAGACACTGG - Intergenic
985491671 5:183331-183353 GCGTGCAGAGGAGCAGCCAAGGG + Exonic
985563353 5:603062-603084 GTTTGTTGAGCAGCAGACACAGG + Intergenic
985573032 5:660688-660710 ACTTGTACAGCAGGAGCCACAGG + Exonic
985575577 5:672034-672056 GTTTGGAGGGCAGCCGCCACAGG - Intronic
985674977 5:1226266-1226288 GCATGAAGAGAAGCAGGCACAGG - Intronic
985724139 5:1506840-1506862 GTTTACAGACCTGCAGCCACAGG + Intronic
985780348 5:1867631-1867653 GTTTGCTGAGCAGCAGAGACAGG + Intergenic
985915181 5:2912831-2912853 GCTTGCAGAGCTCTCGCCACGGG + Intergenic
986173707 5:5334160-5334182 GGTTGCAGATCAGCAGACAACGG + Intergenic
986238346 5:5933658-5933680 CCTTGCAGACAAGCAGCAACTGG + Intergenic
989748402 5:44860406-44860428 GCTTTCAGAGGAGTAGCCCCTGG + Intergenic
990210935 5:53480830-53480852 ACTGGCAGAGCAGCAGCAGCAGG - Exonic
990618873 5:57538563-57538585 GCCTGCAGAGCTGCAGCAACTGG - Intergenic
993393940 5:87358584-87358606 GCATGCTGCGCAGCAGTCACTGG + Intronic
994089018 5:95792102-95792124 GCAGGCAGGGCAGCAGCAACAGG + Intronic
994193943 5:96901020-96901042 ACTAGCAGTGCAGCAGCCAGAGG + Intronic
994630067 5:102274476-102274498 GCTTGGAGAGCAGCAGGCTGTGG - Intronic
994970458 5:106730692-106730714 TCTGGCAGAGCAGCCCCCACTGG + Intergenic
997307985 5:132854387-132854409 GCTTCAAGGGCAGCAGCTACTGG - Intergenic
997588704 5:135060032-135060054 GCTTTCAGAACAGCAGCAGCAGG + Intronic
998953007 5:147411087-147411109 GTTTTCAGGGCAGCAGCCAGAGG - Intronic
1001441804 5:171749410-171749432 CCTTGGAGGGCAGCAGCCATGGG + Intergenic
1001755701 5:174166952-174166974 GCTTCCAGGACAGCAGTCACAGG - Intronic
1001806332 5:174589914-174589936 GCTCGCAGAAAAGCCGCCACAGG - Intergenic
1002603154 5:180366430-180366452 GCTGGAAAAGCAGCAGCCCCAGG + Intergenic
1003235942 6:4295167-4295189 TCTGGCTGAGCAGCACCCACTGG - Intergenic
1007575940 6:42925292-42925314 GCTTGAAGAGCAGCAGCCGCAGG - Exonic
1008271411 6:49494752-49494774 CCTTCCAGAGCAGCAGCCTGAGG - Intergenic
1008550148 6:52621064-52621086 GGTTGCAGAGGGGCAGCCATAGG - Intergenic
1010413363 6:75586071-75586093 GCTCGCAGAGCTCCAGCCAAAGG + Intergenic
1012630267 6:101457833-101457855 GCTTTCAGAGTAGTAGCCACAGG - Intronic
1013106705 6:107031911-107031933 TCTTGAGAAGCAGCAGCCACAGG + Intronic
1016800573 6:148164841-148164863 GCTCCCAGAGCCACAGCCACCGG - Intergenic
1017360610 6:153564840-153564862 ACTGGCAGAGAGGCAGCCACTGG + Intergenic
1017721270 6:157244933-157244955 GTTTGCAGAGAAGCAGGCTCAGG + Intergenic
1018190382 6:161305006-161305028 GGCTGCAGAGCAGGAGGCACGGG + Intergenic
1018198491 6:161375324-161375346 GCTTGGAGAGCCCCAGCCCCAGG + Intronic
1019279848 7:194021-194043 GCTTCCTCACCAGCAGCCACAGG - Intronic
1019702091 7:2478922-2478944 GCTGGCTGGGCACCAGCCACTGG + Intergenic
1019722072 7:2578617-2578639 GCGTGAAGAGCAGCAGGCAGGGG + Intronic
1020110271 7:5443869-5443891 GACTGCAGAGAAGCAGCAACGGG + Intronic
1020244353 7:6419391-6419413 GCCTGCCCAGCACCAGCCACAGG - Intronic
1021106536 7:16645399-16645421 CCTTGCAGAACCGCAGCCAAAGG + Intronic
1023431320 7:40094356-40094378 GCTTGCTCAGCATCAGCCCCAGG + Exonic
1024633202 7:51265715-51265737 GGTTGCAGAGGAACAGGCACAGG - Intronic
1025604562 7:63030171-63030193 GCTTGCAGAGCAGCTGTGTCTGG + Intergenic
1026704262 7:72676569-72676591 GCTGGAAGAGCAGCAGCCCTGGG + Intronic
1026765028 7:73154998-73155020 GCCGGCAGAGCAGCAGCCGAGGG - Intergenic
1030109398 7:106013632-106013654 GCTGGGAAAGCAGCAGCCTCAGG + Intronic
1032868240 7:135951261-135951283 ACTTGAAAAGCAACAGCCACAGG + Intronic
1032947764 7:136871296-136871318 GCCTGCAGCGCTGCAGCCGCAGG - Intronic
1033418109 7:141182206-141182228 GCTCGCCGGGCAGCAGCCTCAGG + Intronic
1034341334 7:150358246-150358268 GCTTGCCAAGCAGCAGCCAAGGG + Intergenic
1035025857 7:155825134-155825156 GTTTGCAGAGCTGCATCCAGAGG + Intergenic
1035290446 7:157834682-157834704 GCTCGCAGAGGGGAAGCCACGGG + Intronic
1036780410 8:11642956-11642978 GCTTGCAGAGCAGCTGTGTCTGG - Intergenic
1037143059 8:15540517-15540539 GGATGCAGAGCAGCAGCAGCAGG - Exonic
1037854282 8:22359585-22359607 GGTTGCAGAGCTGCAGGAACTGG + Intergenic
1039672127 8:39613056-39613078 GCATGCATGGCAGCAGCAACAGG - Intronic
1040845458 8:51833252-51833274 GCTTGCTGAACACCAGGCACAGG + Intronic
1042249773 8:66744312-66744334 GCTTCCAGAGAGGCAGCAACAGG - Intronic
1042661919 8:71163969-71163991 TCTTGCATAGAAGCAGTCACAGG + Intergenic
1043487183 8:80709777-80709799 CCTTGGAGAGGAGCAGCCCCAGG + Intronic
1045353170 8:101360909-101360931 GCTGGCGGAGCAGCGGCCAGAGG - Intergenic
1045691017 8:104759862-104759884 GCTTGCAGAACAGCGGCCCCTGG + Intronic
1046613878 8:116454686-116454708 TCTTGCAGGGCGGCAGCTACAGG - Intergenic
1047061760 8:121235256-121235278 GATAGCAGAGTAACAGCCACCGG - Intergenic
1047390976 8:124451122-124451144 GCTTCCAGAGCAGCACCTGCAGG + Exonic
1047421206 8:124709792-124709814 ATTTGAAGAGAAGCAGCCACAGG - Intronic
1048443813 8:134478628-134478650 GCTTGCCGAGCAGCACCACCTGG - Exonic
1049349238 8:142155131-142155153 GCTGGCACAGCAGCAGCCCCTGG + Intergenic
1049573101 8:143378675-143378697 GCCTGCAGGGCAGGAGCCACTGG - Exonic
1049696453 8:143986407-143986429 GCTTGCTGAGGGGCAGGCACAGG - Exonic
1052916244 9:33926171-33926193 GATTGCAGAAGAGCAGTCACTGG + Intronic
1055933959 9:81587953-81587975 TCTTGCACATCAGCAGACACTGG - Intronic
1056368029 9:85925718-85925740 GCTTGCTGACCAGAAGTCACTGG - Intergenic
1057208124 9:93185148-93185170 TCTTGCAGAGCAGAAGCACCCGG - Exonic
1057449519 9:95144270-95144292 ACTTGCTGAGCTGAAGCCACAGG + Intronic
1057562848 9:96141467-96141489 GATTGCTTAGCAGCAGTCACAGG + Intergenic
1059257059 9:112940493-112940515 GCTGGAAGTGCAGCAGCCAAGGG - Intergenic
1059770095 9:117415760-117415782 GCTTGCAGGGCGGCAGCTAGGGG - Intergenic
1060533811 9:124366852-124366874 GCTTGCAGCCCAGGAGCAACAGG + Intronic
1062662775 9:137647538-137647560 GCGTGCAGAGCAGCAACGCCTGG - Intronic
1203689427 Un_GL000214v1:28925-28947 GCTCCCAGAGCAGCAGCCTAGGG + Intergenic
1203712610 Un_KI270742v1:111424-111446 GCTCCCAGAGCAGCAGCCTAGGG - Intergenic
1203556204 Un_KI270743v1:209743-209765 GCTCCCAGAGCAGCAGCCTAGGG - Intergenic
1203646848 Un_KI270751v1:75128-75150 GCTCCCAGAGCAGCAGCCTAGGG - Intergenic
1185452530 X:290485-290507 GCTGGGAGCGCTGCAGCCACGGG - Intronic
1185604177 X:1358169-1358191 GCAGGCATAGCTGCAGCCACAGG + Intronic
1187487996 X:19722622-19722644 GCTTGCAGCCCGGCAGGCACTGG - Intronic
1190190400 X:48272239-48272261 GGTTGTATAGCAGCAGCCAAGGG + Intronic
1190659133 X:52638729-52638751 GGTTGTATAGCAGCAGCCAAGGG + Intergenic
1192593988 X:72387290-72387312 GCAGGGAGAGGAGCAGCCACTGG - Intronic
1195524489 X:105871090-105871112 GATTTCAGAGTAGTAGCCACAGG + Intronic
1195967547 X:110442416-110442438 GCTTGCAAACTGGCAGCCACAGG - Intronic
1196245348 X:113392535-113392557 GTTGCCAGAGCTGCAGCCACTGG + Intergenic
1197345958 X:125326136-125326158 GCTTGCAAGGCAGCAGCACCAGG - Intergenic
1198314092 X:135449638-135449660 GTGTCCACAGCAGCAGCCACTGG - Intergenic
1200686883 Y:6265821-6265843 GCTTGCAGAGCCCCACCAACAGG + Intergenic
1200989761 Y:9336738-9336760 GCTTGCAGAGCCCCACCAACAGG + Intergenic
1200992429 Y:9357071-9357093 GCTTGCAGAGCCCCACCAACAGG + Intergenic
1200995081 Y:9377349-9377371 GCTTGCAGAGCCCCACCAACAGG + Intronic
1200997746 Y:9397695-9397717 GCTTGCAGAGCCCCACCAACAGG + Intergenic
1201000256 Y:9466229-9466251 GCTTGCAGAGCCCCACCAACAGG + Intergenic
1201002917 Y:9486541-9486563 GCTTGCAGAGCCCCACCAACAGG + Intronic
1201005575 Y:9506824-9506846 GCTTGCAGAGCCCCACCAACAGG + Intergenic
1201008236 Y:9527154-9527176 GCTTGCAGAGCCCCACCAACAGG + Intergenic
1201800043 Y:17945005-17945027 GCCTGCAGAACAGCAGATACTGG - Intergenic
1201801510 Y:17960951-17960973 GCCTGCAGAACAGCAGATACTGG + Intergenic