ID: 967417820

View in Genome Browser
Species Human (GRCh38)
Location 3:189238651-189238673
Sequence CTGTGCTAGGAGAGATGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 230}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967417816_967417820 15 Left 967417816 3:189238613-189238635 CCCCTCTCTCTTCTGAGTTGATC 0: 1
1: 0
2: 1
3: 14
4: 253
Right 967417820 3:189238651-189238673 CTGTGCTAGGAGAGATGTGAAGG 0: 1
1: 0
2: 0
3: 20
4: 230
967417818_967417820 13 Left 967417818 3:189238615-189238637 CCTCTCTCTTCTGAGTTGATCAA 0: 1
1: 0
2: 1
3: 15
4: 212
Right 967417820 3:189238651-189238673 CTGTGCTAGGAGAGATGTGAAGG 0: 1
1: 0
2: 0
3: 20
4: 230
967417817_967417820 14 Left 967417817 3:189238614-189238636 CCCTCTCTCTTCTGAGTTGATCA 0: 1
1: 0
2: 0
3: 25
4: 253
Right 967417820 3:189238651-189238673 CTGTGCTAGGAGAGATGTGAAGG 0: 1
1: 0
2: 0
3: 20
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967417820 Original CRISPR CTGTGCTAGGAGAGATGTGA AGG Intronic
900575130 1:3379199-3379221 GTGTGCTGGGAGAGGTGTGCTGG - Intronic
901761023 1:11471717-11471739 CTGTGCTTGGAGAGCTGGGCTGG - Intergenic
903655651 1:24947561-24947583 CTGAGCTAGGAGGGACCTGACGG + Intronic
904046528 1:27612564-27612586 CAGTGATAGGAGAGAAGTGAGGG + Exonic
905853193 1:41289460-41289482 CTGAGGTTGGAGAGAAGTGAGGG + Intergenic
906743747 1:48207366-48207388 CAGTGCCAGGAGGGCTGTGAAGG - Intergenic
907283838 1:53367910-53367932 CCGTGCTTGGAGAATTGTGAGGG - Intergenic
908439386 1:64138488-64138510 ATGTGCTATGAGGAATGTGAAGG + Intronic
909371533 1:74888528-74888550 GTGGGCTAGGAGAGAGATGATGG - Intergenic
912130354 1:106591872-106591894 ATATGCTGAGAGAGATGTGAGGG - Intergenic
912329268 1:108802556-108802578 CTGAGCTGGGAGAGCAGTGAGGG + Intronic
913193577 1:116433851-116433873 CTGTGCTCAGAGACAAGTGAAGG - Intergenic
913254766 1:116943626-116943648 CTGTGCTCTGAGAGATGAGCTGG + Intronic
914493638 1:148172194-148172216 CTGTGGGAGGAGAGATGGGCTGG - Intergenic
915645586 1:157269717-157269739 AAGTGCTATGAGAGTTGTGAAGG + Intergenic
916071315 1:161171720-161171742 CTGTTCTCAGAGGGATGTGAGGG - Exonic
918987234 1:191647911-191647933 ATGTGCCAGGGGAGATGTGATGG + Intergenic
919868884 1:201805165-201805187 TTGTGCTAGGTGTGTTGTGAAGG + Intronic
923015839 1:230126226-230126248 CTGTGCTAGGAGAGGGCTGTAGG + Intronic
923373663 1:233338668-233338690 GTGTGCTGGGAGAAAAGTGAAGG + Intronic
923518107 1:234714271-234714293 CTGATCTAGGAAAGGTGTGATGG + Intergenic
923593907 1:235345402-235345424 CTCTGCTAGGAAAGATTAGATGG - Intergenic
1063706790 10:8438666-8438688 CTGTGGTATGACAGAAGTGAGGG + Intergenic
1064049733 10:12049655-12049677 CTGGGCGAGGAGGGAGGTGAAGG + Intergenic
1065018083 10:21479894-21479916 AAGTGCTATGAGAGAGGTGAGGG + Intergenic
1067292843 10:44957021-44957043 CTGGGGGAGGAGAGATCTGAGGG - Intergenic
1068629504 10:59284909-59284931 CTATGTGAGGAGAGGTGTGAAGG - Intronic
1072228500 10:93392371-93392393 CTGCCCTAGGAGAATTGTGATGG + Intronic
1072319234 10:94232797-94232819 CTGTGCTTGCAGAGTTGGGAGGG - Intronic
1072735212 10:97874527-97874549 CTGTGGTGGGAGAGATGGGCAGG - Intronic
1072786360 10:98285777-98285799 TCCTGCTAGGAGAGATCTGAGGG - Intergenic
1073189791 10:101643233-101643255 CTGGGCTAGGAGTGATGTGTGGG - Intronic
1073191255 10:101651867-101651889 CTGTGCTAAGTGAGATGAAAGGG + Intronic
1073279358 10:102340986-102341008 CTGTTCTATGAAAGATGTTAAGG + Intronic
1073811025 10:107152300-107152322 CTCTGCTAGGACAGAGGAGAAGG + Intronic
1074308583 10:112301533-112301555 TTGTGGTAGCAGAGATGGGATGG + Intronic
1074654596 10:115570679-115570701 CTGTGGTTGGAGTGATGTGTTGG + Intronic
1075447776 10:122525790-122525812 CTGGGCTAGGAGAGAAGGCAAGG + Intergenic
1075647139 10:124104042-124104064 CTCTCCTAGGAGAGACCTGAAGG - Intergenic
1075715680 10:124553872-124553894 CTGTGGTAAGACAGATGTGGTGG - Intronic
1076000349 10:126907971-126907993 AAATGCTAGGAAAGATGTGAAGG + Intronic
1076595553 10:131622956-131622978 CAGTGCTTGGAGAGAGGTGGGGG + Intergenic
1078169568 11:8919240-8919262 CTGTCCTTGCAGAGGTGTGATGG - Intronic
1078468707 11:11570037-11570059 CTCTGCAAGCAGAGACGTGAGGG + Intronic
1080392845 11:31864461-31864483 CTGTGCTAGGAACTATGTGGGGG + Intronic
1084785229 11:71438167-71438189 CTGGGCTGGGAGAGATGCCAGGG - Intronic
1085065077 11:73487886-73487908 CAGGGTTAGGAGAGAGGTGAGGG - Intronic
1085790106 11:79490110-79490132 CTGAGCTAGATGAGATGTGAGGG + Intergenic
1087947731 11:104184603-104184625 CTGTGACAGGAAAGATGAGATGG + Intergenic
1088237770 11:107743463-107743485 TTGTGCTAAGGGAGACGTGAGGG - Intergenic
1089832107 11:121337924-121337946 CTCTGCCAGCAGAGAAGTGAAGG + Intergenic
1090027780 11:123182433-123182455 CTGTCCAAGGAGAGATCAGAAGG - Intronic
1090440722 11:126723233-126723255 CTCTGCTAGGAGGGCTGTGGAGG - Intronic
1091592909 12:1855932-1855954 CTTTGCCAGGAGAGGTGGGAAGG - Intronic
1093607161 12:21106138-21106160 CTCTGAATGGAGAGATGTGAGGG - Intronic
1097181800 12:57175886-57175908 CTGGGATGGGAGGGATGTGATGG - Intronic
1097563552 12:61239300-61239322 CTGTGCTGGGTGAGACCTGAAGG + Intergenic
1098857787 12:75672401-75672423 CTGTGCAAGGAGAGAGGAGAAGG + Intergenic
1099531249 12:83784318-83784340 ATTTTCTAGGAGAGCTGTGATGG + Intergenic
1102022384 12:109692837-109692859 CTGTCCTAGCAGAAAGGTGAAGG - Intergenic
1102331850 12:112039717-112039739 ACCTGCTTGGAGAGATGTGACGG - Intronic
1102816087 12:115867670-115867692 CTGAGTGAGGAGGGATGTGAAGG - Intergenic
1103160219 12:118722630-118722652 CTGAGCCAGGAGAGACCTGAGGG - Intergenic
1103302768 12:119940801-119940823 CTGTGCCATGAGTGATCTGATGG + Intergenic
1104040736 12:125128662-125128684 CTGTGCTAGGAGGGGTGAGCAGG + Intronic
1104099765 12:125596078-125596100 TTGTACTAACAGAGATGTGATGG + Intronic
1104572859 12:129940513-129940535 CTGTGCGAAGGTAGATGTGAAGG + Intergenic
1105320708 13:19318724-19318746 CTATAGTAGGAGAGATGTGCTGG - Intergenic
1105797386 13:23868829-23868851 TTGTGCTAGGTGAGGTGTTACGG - Intronic
1106848803 13:33766099-33766121 CTGAGCTGGGAGAGAAGGGATGG - Intergenic
1110191070 13:72728934-72728956 CTGTGCTATGGGAGATGTCAAGG + Exonic
1112130251 13:96515645-96515667 TGGTGTGAGGAGAGATGTGATGG + Intronic
1113492472 13:110703327-110703349 CAATGCTAGGAGAGCTGAGATGG + Intronic
1113608832 13:111629020-111629042 CAGGGCTGGGAGAGATGTGCGGG + Intronic
1114497299 14:23141814-23141836 CTGTGCTAGGGGGGCTGGGAAGG - Intronic
1117324575 14:54657355-54657377 CTGTCCTTGAAGAGATGGGAAGG - Intronic
1117622016 14:57597233-57597255 CTGTATTAGGAGTGATGTGTGGG + Intronic
1117647580 14:57867474-57867496 CTGGGCTAGGAAAGATGGAAGGG + Intronic
1119180518 14:72601919-72601941 CTGTGCTATGAGAGTTCAGAAGG - Intergenic
1121669574 14:95697817-95697839 CTGAACGAGGAGAGCTGTGAGGG + Intergenic
1121793144 14:96713813-96713835 GTGTGCTGGGAGAAAGGTGAAGG - Intergenic
1121988322 14:98529564-98529586 CGGTTCTAGGAGAGAGGAGAGGG + Intergenic
1122255736 14:100474356-100474378 CTGTGTTTGTGGAGATGTGAAGG - Intronic
1122508509 14:102247631-102247653 TTGTGATTGGAGAGTTGTGATGG - Intronic
1124215978 15:27807303-27807325 CTGTGGTCTGAGAGAAGTGAGGG - Intronic
1128553609 15:68615048-68615070 CTCTGAGAGGAGAGAGGTGAGGG + Intronic
1128695328 15:69757665-69757687 TGGGGCTAGGAGAGATGGGAAGG - Intergenic
1128769167 15:70268964-70268986 CTGGGCTCGGCGAGGTGTGAAGG - Intergenic
1130135827 15:81181269-81181291 CTGTGCCAGGAGCACTGTGAGGG - Intronic
1131259765 15:90882276-90882298 CTGGCCTAGGAGATATCTGAGGG + Exonic
1131676323 15:94674147-94674169 CTGTTCTAGAAGAGATTTTAGGG - Intergenic
1132078131 15:98840127-98840149 CTGTGCTAGCAAAGATGTCCGGG - Intronic
1132727467 16:1345226-1345248 CTGTGGTGGGAGGGTTGTGAGGG - Intronic
1132806772 16:1778608-1778630 CTGTGCTGGGAGAGAAGGGCCGG + Exonic
1135586350 16:23674562-23674584 GTGTGCTGGGAGAAAAGTGAGGG - Exonic
1137782239 16:51107519-51107541 CTGGGCTCTGAGAGGTGTGAGGG - Intergenic
1140254738 16:73325353-73325375 CAGTGCTAAGACAGATGTGTGGG + Intergenic
1141063945 16:80899063-80899085 ATGTGCTAGGCCAGATGTGGTGG - Intergenic
1141563302 16:84884611-84884633 CTGTGAGAGGAGAGGTGTGGAGG + Intronic
1141646041 16:85368304-85368326 TTGTGCTGGGAGAGTTCTGAAGG + Intergenic
1144462387 17:15468517-15468539 CTGTGGTTGCAGAGAAGTGAGGG - Intronic
1145752817 17:27367505-27367527 CTGTTTTAGGAGCTATGTGAGGG - Intergenic
1147706697 17:42430201-42430223 CTGTGCTGGGAGAGATCCCAGGG + Intergenic
1148090504 17:45020171-45020193 CAGTTCTGGGAGAGATGTGATGG + Intergenic
1149795406 17:59514501-59514523 CTGTGCTAGGGGAAAGATGATGG - Intergenic
1149958487 17:61080261-61080283 CTGTGAAAGGAGAGATTTCAAGG - Intronic
1151077443 17:71289708-71289730 CTGACATAGGAGAGATTTGACGG + Intergenic
1151653951 17:75486770-75486792 CTGTGCTGGGAGACATGGGAAGG + Intronic
1153060867 18:993931-993953 CTGAGCTAGGAAAAATTTGAAGG + Intergenic
1154283854 18:13033430-13033452 CTGTCTTAGCAAAGATGTGAGGG + Intronic
1157557127 18:48620071-48620093 ATGTTCTAGGAGAGATCTGGAGG + Intronic
1158024314 18:52877752-52877774 ATATGATAGGAGAGATGTAATGG + Intronic
1158355104 18:56609369-56609391 CTAGGCTAGAAGGGATGTGAGGG + Intronic
1160540144 18:79616845-79616867 CTGTGCTGGGGGAGCTGAGAGGG - Intergenic
1161635709 19:5387624-5387646 CTCTGCTGGGAGAGAGGTAATGG + Intergenic
1163863112 19:19752832-19752854 CTGTGCCGGGAGAGATATAAAGG + Intergenic
1165632125 19:37310815-37310837 CTGAGCAAGGAGAGAGGTAAAGG + Intergenic
925015858 2:523693-523715 CTGTGTGAGGAGAGCTGTGCCGG + Intergenic
925323002 2:2991301-2991323 CTATGCTGGAAGACATGTGAAGG - Intergenic
926758378 2:16253814-16253836 CTGTTCCAGGAGAGTGGTGAGGG + Intergenic
927037550 2:19194939-19194961 CTGAGTGATGAGAGATGTGAAGG + Intergenic
927555648 2:24029628-24029650 CTGGGTTAGGAAAGAAGTGAGGG - Exonic
927867041 2:26595815-26595837 CTTTGCTAGTAGTGATGGGAGGG + Intronic
928325527 2:30316587-30316609 CTGATCAAAGAGAGATGTGAAGG + Intronic
932404310 2:71503480-71503502 CTGGACTAGGGGAGATGGGAAGG + Intronic
933222546 2:79707148-79707170 CTGTGCGAGGACACATGTGCTGG + Intronic
934604113 2:95681371-95681393 CTGTGCTAGGATAGTTCTGTGGG + Intergenic
937081162 2:119140985-119141007 ATGTGCTATGAGAGATGAGAAGG + Intergenic
937873513 2:126803271-126803293 CTGAGCCAGGAGAGATATAAAGG - Intergenic
940164949 2:150760824-150760846 CTGGGCTTGGAGAGTTCTGAGGG - Intergenic
940614016 2:156027987-156028009 CTGACCTAGGAGACTTGTGATGG - Intergenic
940826450 2:158417599-158417621 CTGTGAAAGGAGAGACGGGAAGG - Intronic
941380137 2:164782580-164782602 CTGGGCTAGGATAGTGGTGATGG + Intronic
942864520 2:180657078-180657100 CTGGGATAGGAGAAATATGAAGG + Intergenic
943704093 2:191016647-191016669 ATGTGCAAGGAGAGTTGTTAAGG - Intronic
948954809 2:241280018-241280040 CTGTGGGAGCAGAGATGTGGAGG + Intronic
1170532367 20:17307521-17307543 CTGTACTAGGAGAGATCCTATGG - Intronic
1171453801 20:25255286-25255308 CTGTGGGAGGAGAGATGTTGAGG - Intronic
1174171835 20:48622547-48622569 CTGTGCTTGCAGAGTTGGGAGGG - Intergenic
1175096250 20:56543719-56543741 ATGTGATAGGAGAGATGGGAGGG - Intergenic
1176075806 20:63247771-63247793 CTGTCCTAGGGGAGAGGTGCAGG + Exonic
1178578375 21:33815322-33815344 CTGAGCTAGGACAGATGCAAAGG - Intronic
1180600471 22:17012163-17012185 CTGTGCTAGGGGAGCAGTGAGGG + Intergenic
1183194096 22:36341397-36341419 CTGTGATGGCATAGATGTGAGGG + Exonic
1184924352 22:47626597-47626619 CTGTGCCAGCAGACATGTGTGGG - Intergenic
949534660 3:4986696-4986718 CTGGGCTAGAAGAGAGGTTAAGG - Intergenic
950565508 3:13767445-13767467 CTGGGGTAGGAGACAGGTGATGG + Intergenic
950627484 3:14258944-14258966 CTGTGCTAGGCATGATGGGAGGG + Intergenic
951440460 3:22717299-22717321 GAGTGCTAGGAGAGAAGAGATGG + Intergenic
951467237 3:23014502-23014524 CTGTGCTCAGAGAGGTATGAAGG + Intergenic
952740088 3:36726446-36726468 CAGTTCCAGGAGAGATGTGAGGG - Intronic
952893566 3:38061076-38061098 TTGTGCTAAGAGATTTGTGATGG + Intronic
954301575 3:49703337-49703359 CTGTGCTAGGCCAGATTGGAGGG + Intronic
955453490 3:59095988-59096010 CTGTGCTAGGTTAGATGTTGGGG + Intergenic
955567409 3:60262385-60262407 CTGTGCTTGCAGAAAAGTGATGG + Intronic
956521379 3:70107880-70107902 ATGTGTTAGGTGAGATGGGAAGG + Intergenic
958922566 3:100123224-100123246 CTGAGATGGGAGTGATGTGAAGG + Intronic
959113596 3:102150012-102150034 CTGTCCTACGAGAAATGTTAAGG + Intronic
961346724 3:126268079-126268101 CTGAGCTAAGGGAGATGTGGGGG - Intergenic
962259136 3:133892170-133892192 CAGTGGTAGGAGACATGGGAGGG - Intronic
963198194 3:142557655-142557677 CTGGGCTATTAGAGATATGATGG - Intronic
964633413 3:158836438-158836460 ATGTGCTAAGAGAGGTGTGGAGG + Intergenic
966614534 3:181899097-181899119 ATGTGGTAGGAGAGAAGAGAAGG - Intergenic
966643099 3:182212268-182212290 CTGTGCTTGGATATATGTGAGGG - Intergenic
967417820 3:189238651-189238673 CTGTGCTAGGAGAGATGTGAAGG + Intronic
970021467 4:11574263-11574285 CTGTGCCAGGGGAGATGTCAAGG - Intergenic
972332737 4:38078931-38078953 CTTTGTTAGGGGAGATTTGAGGG + Intronic
972889084 4:43532859-43532881 CTTTTCTAGTAGAAATGTGATGG + Intergenic
973259786 4:48151135-48151157 CTGCGCTAGGAGAGTAGTTAAGG + Intronic
974019646 4:56681536-56681558 CTTGGCTAGGAGAGAGGTCAGGG - Exonic
975615176 4:76238641-76238663 ATAATCTAGGAGAGATGTGATGG + Intronic
975827761 4:78337735-78337757 CATTGGTAAGAGAGATGTGAGGG - Exonic
978692402 4:111529667-111529689 CTGTGGTGGGAGGGAAGTGAGGG + Intergenic
980347302 4:131637039-131637061 CAGTGCTAAGTCAGATGTGAAGG - Intergenic
983907328 4:173197736-173197758 CTGTGGTTGGAGAGAAGTGGGGG + Intronic
984706191 4:182848977-182848999 CTGAGATAGGAAAGATGAGAGGG - Intergenic
984856127 4:184197802-184197824 ATGTGCAAGGAGGGATGTCATGG + Intronic
985889667 5:2705701-2705723 CTGTGCTGGGAGTGAGGGGAGGG + Intergenic
987170561 5:15253011-15253033 ATGTATTAGGAGAGGTGTGACGG + Intergenic
988454838 5:31378255-31378277 GTGTGGTGGGAGAGAAGTGAGGG + Intergenic
988563702 5:32303385-32303407 CAGTGCTGGGAGAGATGGAAAGG - Intronic
988689407 5:33557455-33557477 ATGTGCTAAGAAAGATTTGAAGG - Intronic
989398394 5:40982787-40982809 CTGTGGGAGGAGAAATGAGAGGG + Exonic
989611292 5:43294690-43294712 CTGTGCTAGAACAGATGCAAGGG + Exonic
990508159 5:56465550-56465572 CTGGGTGAGGAGAGATGTGTGGG - Intronic
991920550 5:71652460-71652482 CTCTGTTAGGAGAGATGGGATGG + Intronic
995687415 5:114785585-114785607 TCCTGCTGGGAGAGATGTGACGG - Intergenic
996819592 5:127611849-127611871 ATGTCCTAGTGGAGATGTGAAGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998374930 5:141683988-141684010 TGGAGCTAGGAGAGCTGTGAAGG - Intergenic
998426068 5:142029707-142029729 CAGGGCTAGGAGAGATGCCATGG + Intergenic
998725708 5:145011300-145011322 CTGTGCTAGTAGTCATGTTATGG + Intergenic
1000364973 5:160482093-160482115 CAGTGCTGGGACAGTTGTGATGG + Intergenic
1002099906 5:176852211-176852233 CTCTGCCAGGTGAGAGGTGAGGG + Intronic
1002338082 5:178494299-178494321 CCTTCCTAGGAGAGATGGGAAGG + Intronic
1004255522 6:14059974-14059996 CTGTGCTGGGAGACATTGGAGGG + Intergenic
1005912766 6:30325939-30325961 GTATGCTGGGAGAGGTGTGAGGG - Intergenic
1006115818 6:31775740-31775762 CTGTGGCTGGAGAGAAGTGAGGG - Intronic
1006129565 6:31861161-31861183 CTGTCCTAGGAGATAGGTGGAGG - Intronic
1006511558 6:34524289-34524311 CTGTGCTGGGGGAGAGCTGAGGG - Intronic
1009245640 6:61233543-61233565 CTGTCCTAGAAGAAATGTTAAGG + Intergenic
1010252357 6:73721195-73721217 CTGTGCTAGGTGGTAAGTGATGG + Intronic
1011180907 6:84619308-84619330 CTTTGCTAGGGGGGCTGTGAGGG + Intergenic
1011536184 6:88378824-88378846 TTATGCTGGGAGAGATATGACGG - Intergenic
1012858708 6:104533397-104533419 CTGTCCTTGGGGGGATGTGAAGG - Intergenic
1016683595 6:146857285-146857307 CAGTGCTTGGAGGAATGTGAAGG - Intergenic
1019094086 6:169564742-169564764 CAGTGCTAGAAGAGAAGTCAGGG - Intronic
1024086265 7:45894260-45894282 AGGTGCTAGGAAAGATGTGGAGG - Intergenic
1028366394 7:90037526-90037548 CTGGGCTAGAAGAGGTGTGGTGG + Intergenic
1028751629 7:94389937-94389959 CTGAACTAGGATAGATGTGGTGG - Intergenic
1029180176 7:98694925-98694947 CTGGGCCAGGATAGATGAGAAGG + Intergenic
1032261286 7:130338980-130339002 CTGAGTTAGGTAAGATGTGAAGG - Intergenic
1032492413 7:132333467-132333489 CAGTGCCAGGGGAGGTGTGATGG + Intronic
1033019388 7:137707393-137707415 CAGTGCTGGGAGAGCTGTGTGGG - Intronic
1035035236 7:155890395-155890417 CTGTGCTAGAACAGCTGCGAGGG - Intergenic
1035559253 8:592978-593000 CTGTGATAGGAGGGCAGTGAGGG + Intergenic
1035559282 8:593098-593120 CTGTGAGGGGAGGGATGTGAGGG + Intergenic
1035559301 8:593181-593203 CTGTGAGGGGAGGGATGTGAGGG + Intergenic
1035559308 8:593209-593231 CTGTGAGGGGAGGGATGTGAAGG + Intergenic
1035559321 8:593251-593273 CTGTGAGGGGAGGGATGTGAGGG + Intergenic
1035559378 8:593460-593482 CTGTGAGGGGAGAGATGTGAGGG + Intergenic
1035559408 8:593585-593607 CTGTGAGGGGAGAGATGTGAGGG + Intergenic
1035559460 8:593794-593816 CCGTGAGGGGAGAGATGTGAGGG + Intergenic
1035559490 8:593946-593968 CCGTGAGGGGAGAGATGTGAAGG + Intergenic
1036786620 8:11692272-11692294 CTGTGCTTGAAAAGGTGTGATGG - Intronic
1037187716 8:16084165-16084187 CTGTGATTTTAGAGATGTGATGG + Intergenic
1039625787 8:39050967-39050989 CTGTGCTCTGAGAGAGGAGAGGG + Intronic
1044371726 8:91419991-91420013 CCGCTCTAGGAGAGAAGTGATGG + Intergenic
1046786010 8:118267527-118267549 GTTTGCTAGGAAAGATGAGATGG + Intronic
1047875621 8:129134239-129134261 CTGTGCTAGAGGAGCTGTGGTGG + Intergenic
1048068641 8:130999117-130999139 CTGTGCTAGGAGATAAGAGACGG - Intronic
1049210326 8:141383542-141383564 CTGGGCCAGGAGCGAGGTGAGGG + Intergenic
1051395195 9:16612890-16612912 CTGAGCTAGGAGATATGTGTGGG - Intronic
1051733718 9:20175969-20175991 CTGAGCTAGGAAGGATGTGGAGG + Intergenic
1052847135 9:33346762-33346784 CTGTGCTGCAAGAGATGAGATGG + Intronic
1053006153 9:34605997-34606019 CTGGGCCAGGAGGGAAGTGAGGG - Intergenic
1054834411 9:69661397-69661419 CTGTGCAGGAAGAGATGGGAAGG + Intronic
1059615898 9:115950334-115950356 GTGGGCTAGGAGAGATGGGCTGG - Intergenic
1060152650 9:121298788-121298810 CAGTGCTAGGAGGGAGGAGAGGG + Intronic
1060913844 9:127372286-127372308 ATGTGCTATAAGAGATGTGTAGG + Intronic
1062679699 9:137772207-137772229 TTGTGCTTGGAGAGGTGTGCTGG - Intronic
1185700914 X:2229121-2229143 TTGTGCTGAGAGAGATCTGAGGG + Intronic
1186225524 X:7395267-7395289 CTTTGCTAGTAGAAAAGTGAAGG - Intergenic
1192694403 X:73399321-73399343 TGGTGCTAGGAGAGGGGTGATGG - Intergenic
1194603948 X:95958258-95958280 GTGTTGAAGGAGAGATGTGATGG - Intergenic
1194921880 X:99777763-99777785 CTGTGCTGGGTTAGACGTGAGGG + Intergenic
1197406357 X:126056691-126056713 TTGAGCTGAGAGAGATGTGAGGG - Intergenic
1199768358 X:150957093-150957115 CTGTGCTAGGACAGAATTGGAGG + Intergenic
1199947923 X:152682398-152682420 CCCTGCTAGGAGAAACGTGAAGG + Intergenic
1199961756 X:152786056-152786078 CCCTGCTAGGAGAAACGTGAAGG - Intergenic
1201652374 Y:16303990-16304012 CTGTTCTACTAGAGATGTGAGGG - Intergenic