ID: 967420308

View in Genome Browser
Species Human (GRCh38)
Location 3:189265143-189265165
Sequence TTGTATATGAATAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967420308 Original CRISPR TTGTATATGAATAAGGAGGA AGG Intronic
900836989 1:5012617-5012639 TTGTATTTGCATAAGGAAGGGGG + Intergenic
901651082 1:10743614-10743636 TTCTATAAAAATAAGGAGGGAGG + Intronic
904993009 1:34608879-34608901 TTGAATAGGAATAAGGAAAACGG - Intergenic
905856792 1:41319834-41319856 CTGTAAATGAAAAATGAGGAGGG - Intergenic
908188484 1:61675864-61675886 TTGTATAGTGATTAGGAGGACGG + Intergenic
908457963 1:64322417-64322439 CTGAATATGAATAAGGCAGAGGG + Intergenic
909733641 1:78929174-78929196 TTTTAGAAGAGTAAGGAGGAAGG - Intronic
909741156 1:79031185-79031207 TTTTATATGAATATTGAGAATGG + Intergenic
910556030 1:88533979-88534001 TTGTATAAGAATTAGCAGGAAGG - Intergenic
910912538 1:92253056-92253078 TTCTATATGAATTAGAAGAAAGG - Intronic
911882543 1:103259622-103259644 ATGTGTATGAATAAGTAGGAGGG + Intergenic
911936581 1:103983039-103983061 TTAGATATGAATGTGGAGGAAGG + Intergenic
912578921 1:110703012-110703034 ATGTATTTGAATAATGAAGAGGG - Intergenic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
913440242 1:118889366-118889388 TTGTAAATGATCAAAGAGGATGG - Intronic
914964702 1:152244966-152244988 TTGTATATCAAAAAGGATGCAGG + Intergenic
916191405 1:162182064-162182086 TAGTACATGAAGAAGGAAGATGG - Intronic
916404009 1:164479169-164479191 TTGTATATAAATAAGGTAAATGG + Intergenic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
924523390 1:244824806-244824828 ATGTATATGAAAAGGGAGGCGGG + Intergenic
1063508037 10:6619308-6619330 TTGTAAATGCCTATGGAGGATGG - Intergenic
1064084924 10:12338298-12338320 GTGTTTCTGAAAAAGGAGGAAGG - Intergenic
1064652284 10:17521677-17521699 TTGGATATGAATGAGGGAGAAGG - Intergenic
1065371598 10:24992330-24992352 TTTTAGATAAATAAGGAGGTCGG + Intronic
1065563650 10:26987992-26988014 TTGTGTATGAATAGGGAGAAAGG + Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1066646886 10:37619334-37619356 TTTTATGTGAACATGGAGGAAGG + Intergenic
1067165735 10:43865129-43865151 TTGTTTTTCAATAAGGAAGATGG - Intergenic
1067537320 10:47122894-47122916 CTGTCTATGAAAAAGGAGGCAGG + Intergenic
1068663975 10:59653117-59653139 TTGGATAAGAATAAGCAGGCAGG + Intronic
1068726574 10:60309617-60309639 CTGGAGATGAATAAGGAGGTTGG + Intronic
1069146611 10:64900098-64900120 TTGTTTCTGAATAAAGAGGCAGG - Intergenic
1069203291 10:65650820-65650842 TTGTTTAGGAATAAGGAAAAAGG - Intergenic
1069254201 10:66311755-66311777 TTGTATATGGAAAAGGAATATGG + Intronic
1069332434 10:67308609-67308631 TGGTATATGCATAATGAGTATGG + Intronic
1069509590 10:69031886-69031908 TTGTAGACGGAAAAGGAGGAAGG - Intergenic
1070706657 10:78644095-78644117 TTGTATATGAATACTTAGGTGGG + Intergenic
1075036957 10:119077516-119077538 TTGTATATAAATTAGGACAAAGG - Intronic
1076173635 10:128345792-128345814 TTGTATATGTTTAAGGAGTGAGG + Intergenic
1078269374 11:9780773-9780795 TCGTCTTTGACTAAGGAGGAAGG + Intronic
1079548128 11:21660204-21660226 TTGTCTATGAACTAGGAAGAAGG - Intergenic
1083032271 11:59604007-59604029 CTGTTTCTGAGTAAGGAGGATGG - Intronic
1085235098 11:75008483-75008505 GTGGATAGGAATAGGGAGGATGG + Exonic
1086538104 11:87874124-87874146 TTCTCTATGAACAAGGAGTAGGG - Intergenic
1090683817 11:129092597-129092619 TTGTATATAAATAAGTAAGATGG - Intronic
1092498160 12:9018747-9018769 TTGTATATCAAGAGAGAGGAGGG - Intergenic
1092736788 12:11590339-11590361 TTGCTTATGAATAAACAGGAAGG + Intergenic
1092835031 12:12479256-12479278 TTGCATTTGAATAAGGAACAAGG + Intronic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1093375613 12:18423705-18423727 TTGTATATGGATAAGAAATAAGG - Intronic
1093821807 12:23628629-23628651 TTGGATAAGAAAAAGGAGTACGG + Intronic
1093888981 12:24496857-24496879 TTGTATATTCATAAAGAGCAAGG - Intergenic
1094794288 12:33952478-33952500 TTGAAAATGAGTAAGGAAGATGG - Intergenic
1095148983 12:38768236-38768258 TTGTATATGATTAAGAAAGTAGG - Intronic
1097538023 12:60898524-60898546 ATATATATGAATAAGTAGGATGG + Intergenic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1098351615 12:69568016-69568038 CAATATATGAAAAAGGAGGAGGG - Intronic
1098371418 12:69764311-69764333 TTGTATATGGTGAAGGGGGATGG + Intronic
1099744602 12:86686374-86686396 TTGAATAGGAGTAAGGAAGAGGG + Intronic
1100295694 12:93258825-93258847 TTGTGTATGCATGAAGAGGAAGG - Intergenic
1102367266 12:112348981-112349003 TTGCCTTTGAATGAGGAGGAGGG + Intronic
1102572737 12:113837150-113837172 GTGTATATTAAGTAGGAGGATGG - Intronic
1103619210 12:122175961-122175983 TAAAATATGAATAAGGAGGCCGG - Intronic
1104436324 12:128759781-128759803 ATGTATAAAAATAAGGATGATGG - Intergenic
1104558182 12:129821026-129821048 TTATATAGGAGAAAGGAGGAGGG - Intronic
1108231450 13:48347156-48347178 TTGTATATGTTTAAGGGTGAAGG + Intronic
1108423775 13:50277408-50277430 TTGTAGATGAAGAAAGAGCAGGG + Intronic
1109351867 13:61192975-61192997 TTGGGTGTGAATAAGGAGGGAGG + Intergenic
1109714532 13:66204352-66204374 TTGGAGATGAATAAGGAAGTTGG - Intergenic
1109944716 13:69418990-69419012 ATGTCTATTAACAAGGAGGATGG - Intergenic
1110335056 13:74319024-74319046 TTGTGTAAGACTAAGGAGAATGG - Intergenic
1111720306 13:91935456-91935478 TTGTATATGAAGCAGAAGGGTGG + Intronic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1112150752 13:96760241-96760263 TTGTATCTGAAGATTGAGGAAGG - Intronic
1113094390 13:106648406-106648428 TTGAATATGAATGAGGACTAGGG + Intergenic
1114198371 14:20499482-20499504 TTTTATATGAATGAGAAGAAAGG + Intergenic
1115503325 14:34068520-34068542 TTGTTTATGAATAAGAAAGTGGG - Intronic
1115814648 14:37150414-37150436 ATGTATATGAGTAAGAAAGAGGG - Intronic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1117685183 14:58245502-58245524 TTGTATAGGAAAAACGAGAAAGG - Intronic
1119008493 14:70957601-70957623 TTGTCTAGGGCTAAGGAGGATGG + Intronic
1120614824 14:86690306-86690328 CTGTCTATGAATCAGGAAGAAGG + Intergenic
1120667601 14:87325333-87325355 TTATATATGAATACCAAGGATGG + Intergenic
1120858782 14:89235760-89235782 TTGTCTGTGAAGATGGAGGATGG + Intronic
1123927622 15:25133850-25133872 TTTTACATGGACAAGGAGGAGGG - Intergenic
1124208088 15:27740359-27740381 TTGTGTCTGAATTGGGAGGACGG - Intergenic
1125436893 15:39655715-39655737 GGGCATCTGAATAAGGAGGATGG - Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1129022932 15:72539817-72539839 CTCTATATGAATATTGAGGAGGG + Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129905285 15:79182948-79182970 TTGTCTCTGAAAAAGAAGGAAGG - Intergenic
1131887407 15:96931765-96931787 TTTTATATGAAAAAGGAACATGG + Intergenic
1131981694 15:98000515-98000537 TTGTATTTGAATAAAGATAATGG - Intergenic
1132110472 15:99099061-99099083 TATTATATGGATAAGGAGGTGGG + Intronic
1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG + Intergenic
1133549721 16:6842439-6842461 TTGTATATAAATATAGAGCAAGG - Intronic
1135204476 16:20471378-20471400 ATGTCTATGTATAAGTAGGAAGG - Intronic
1138000019 16:53268529-53268551 ATTTATATGCACAAGGAGGAGGG - Intronic
1138317484 16:56082647-56082669 TTGTCTATGAACCAGGAAGAGGG - Intergenic
1138659109 16:58507438-58507460 TTGTAGAAGAATGAGAAGGAGGG - Intronic
1139811733 16:69624605-69624627 GTGGATAGGGATAAGGAGGAAGG - Intronic
1140279571 16:73542378-73542400 TTGTATAAAAATAAGGACGTTGG - Intergenic
1142923548 17:3212609-3212631 TTCTATTTGAAGAAGGGGGAGGG + Intergenic
1143813131 17:9488607-9488629 TTGTCTTTGAAGACGGAGGAAGG + Intronic
1145908459 17:28529014-28529036 ATGTATATAAATGGGGAGGAGGG + Intronic
1146016963 17:29241465-29241487 TTGTGTGGGAATAAGCAGGATGG - Intergenic
1147517864 17:41139221-41139243 TTTTTTATGAATATGGAGAAGGG - Intergenic
1150563831 17:66320038-66320060 ATGTATATGAATTAAGAGGCAGG - Intronic
1151269723 17:72984818-72984840 TGTTAAATGAATAAGGAGGAAGG + Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1155137014 18:23005858-23005880 TTGCATCTGCATAATGAGGAGGG - Intronic
1155192206 18:23439990-23440012 TGATATGTGAATACGGAGGAAGG - Intergenic
1155608681 18:27637385-27637407 TTGTTTTTGAATAAGAAGGAGGG - Intergenic
1156996744 18:43478380-43478402 TTGACAATGGATAAGGAGGAAGG - Intergenic
1157350237 18:46877605-46877627 TTGAATATGAATAATTAGGTAGG - Intronic
1159869957 18:73750075-73750097 TTGTTGATGAAAACGGAGGAAGG + Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160164583 18:76498803-76498825 CTGTATTTGAATATGGAGGAGGG + Intergenic
1160301969 18:77690193-77690215 TGGTGTCTGAATAAGGAGAACGG - Intergenic
1162330141 19:10023031-10023053 TTGTATATTCTTAAAGAGGAAGG + Intergenic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
926339877 2:11896133-11896155 TGGTGTAGGAAGAAGGAGGATGG + Intergenic
926519610 2:13895036-13895058 TTGTATATGTATATGGTGGTTGG + Intergenic
926525649 2:13976669-13976691 ATGTAGATAAATAAGGAAGAAGG + Intergenic
926544776 2:14226072-14226094 TTGGCTTTGAATATGGAGGAAGG - Intergenic
926548811 2:14275791-14275813 TTGTTTATAAATAAGCTGGAGGG + Intergenic
926582458 2:14646083-14646105 TTCTATAAGAAAAAGGTGGAGGG - Intronic
927479691 2:23442485-23442507 TTGTCTTTGAAGATGGAGGAAGG + Intronic
928791946 2:34967973-34967995 TTATATATGAATAAAGAAAATGG - Intergenic
928885349 2:36142183-36142205 TTGTACATGCATATGGAGGAAGG - Intergenic
929706113 2:44213926-44213948 TTCTTTATGAATGAGGAAGAAGG - Intronic
930247370 2:48998259-48998281 TGGTATATTAATGAGGAGGAAGG + Intronic
931842735 2:66171378-66171400 TTTTATTCAAATAAGGAGGAAGG + Intergenic
932104136 2:68927459-68927481 TTGCAAATGAATAAGGACCACGG + Intergenic
935433370 2:103002276-103002298 CTGTATGTGAATAAGGAGGGTGG + Intergenic
935823659 2:106919445-106919467 TTGTAAATAAATCAGGAGAATGG - Intergenic
936540692 2:113348428-113348450 ATGTACATGAATCAGGATGATGG - Intergenic
936718501 2:115219341-115219363 TTGTACATGAATCATGAGCATGG + Intronic
936918554 2:117664424-117664446 TGGTCTATGCAAAAGGAGGAAGG - Intergenic
939246270 2:139627152-139627174 TTGTGCATGAAAAAGGAGGCTGG + Intergenic
941535774 2:166721134-166721156 TGGTGTAGGAAAAAGGAGGAGGG - Intergenic
941656154 2:168146820-168146842 CTGTATATGAATAGAGAGGTTGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942511306 2:176705066-176705088 TTATATATGAATAAGGTGGTTGG + Intergenic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
943184439 2:184588457-184588479 TTGTTTATGAATACAGAGGCAGG + Intergenic
944879515 2:203997785-203997807 TTGGATTTTACTAAGGAGGAAGG - Intergenic
946120524 2:217509035-217509057 TTGTCTATGAATGAGGAGGTAGG + Intronic
946546337 2:220748667-220748689 ATTTGTATGAAGAAGGAGGAAGG + Intergenic
947019146 2:225655072-225655094 TGGTATATGAACAAAGGGGAAGG + Intergenic
1172473282 20:35217101-35217123 ATGTATATGAGTGAGGAGGTTGG - Intergenic
1172917212 20:38452083-38452105 TTGGGTAGGAATAAGGAGGGGGG - Intergenic
1176293639 21:5059280-5059302 TGGCAGATGAATGAGGAGGAGGG + Intergenic
1178557985 21:33610552-33610574 TTATTTATAAATCAGGAGGATGG - Intronic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179535840 21:42051338-42051360 TTCTATTTGAATAAGGATGATGG - Intergenic
1179863621 21:44204368-44204390 TGGCAGATGAATGAGGAGGAGGG - Intergenic
1181916787 22:26287841-26287863 TTGTGTATGATTAAGGAAAAGGG + Intronic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1183318785 22:37151733-37151755 TTGTATATGAAGAGAGATGAGGG + Intronic
1185160528 22:49225575-49225597 TAGTATATTAATAAAGAAGAAGG - Intergenic
949237541 3:1828251-1828273 GTCCATATAAATAAGGAGGATGG - Intergenic
950933765 3:16817835-16817857 TTGGAAATCAATAAGGAAGAAGG - Intronic
951757286 3:26104894-26104916 TTGTGTGTGAATAAGCAGCAGGG + Intergenic
956665216 3:71636081-71636103 TCGTTTATGAATAAGATGGACGG + Intergenic
958614598 3:96475561-96475583 TTGTATTTGAGAAAGGATGAAGG + Intergenic
959840440 3:110968815-110968837 TTGTAAATCAAAAAGCAGGAAGG - Intergenic
962100588 3:132338172-132338194 TTGTATATGCATAAGGAAATTGG - Intronic
962299274 3:134223557-134223579 TTGTTTATAAAAAGGGAGGAGGG + Intronic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965134672 3:164747362-164747384 TTGAATATGAAAAATGAGGCAGG + Intergenic
966606329 3:181825082-181825104 TTGCATCTGAATAAGGAACAAGG - Intergenic
967050398 3:185778146-185778168 TTGTATTGGAATAAGCAGGTTGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
970340737 4:15103912-15103934 TTGTTTTTGATTAAGGAGGAAGG + Intergenic
971446712 4:26758139-26758161 TTTTATAAGAACAAGGAGAAGGG - Intergenic
971655250 4:29336006-29336028 TTATAGAAGAAAAAGGAGGAAGG - Intergenic
972045970 4:34664576-34664598 TTGTGTCTGAATTTGGAGGAGGG + Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972857665 4:43126748-43126770 TTCTCTATGTATAAGGAGAATGG + Intergenic
973154614 4:46935331-46935353 TTATATATTTATTAGGAGGAAGG - Intronic
974186718 4:58456718-58456740 TTACATGTGAATAAGCAGGAGGG - Intergenic
977444267 4:97109565-97109587 TTGTAGAAGAATATGGAAGAAGG + Intergenic
978145683 4:105368648-105368670 TTGTTCAAGAATAAGGAGAAAGG + Intergenic
978625012 4:110675456-110675478 TAGTATATGTATTTGGAGGAAGG + Intergenic
978758747 4:112332217-112332239 TGGTTTATCAATAAGGAGGAAGG + Intronic
979805293 4:124962655-124962677 TTGCATATGAATAAGCATGTAGG + Intergenic
980479491 4:133369319-133369341 TTATATATGCATAAGGAACAAGG + Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981826514 4:148948211-148948233 TTGAAGATGAATTAGGGGGAGGG + Intergenic
982482382 4:155928149-155928171 TAGTATTTGAAAAAGGAAGAGGG - Intronic
984379522 4:178972861-178972883 TTTTCTATCCATAAGGAGGAAGG - Intergenic
987154045 5:15070003-15070025 TTGTAAAGGAAAAATGAGGAGGG + Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987642559 5:20631501-20631523 TTGTATCTGAAAAAAAAGGAAGG + Intergenic
988357266 5:30194186-30194208 TTGAATATTAATAAGAAGAATGG - Intergenic
988459395 5:31419165-31419187 TTGTGTTTCAAGAAGGAGGAGGG + Intronic
988660150 5:33257657-33257679 CAGCATATGAATTAGGAGGATGG - Intergenic
991202891 5:64014769-64014791 GTGTCTATGAAGAAGGAAGAGGG - Intergenic
991670554 5:69043215-69043237 TTGGATAGGAATAAGACGGAAGG - Intergenic
993877119 5:93320680-93320702 TTGTACATGATTAAAAAGGATGG - Intergenic
994335326 5:98558257-98558279 CTGTATAGGAATGAAGAGGAGGG + Intergenic
994367777 5:98934845-98934867 CTGTATAAGAATTAGGTGGAAGG + Intergenic
995364598 5:111343781-111343803 TTGTATAGGGATAAGGCAGAAGG + Intronic
995424722 5:112007695-112007717 TTGTTTTTTAATAAAGAGGAAGG + Intergenic
995840995 5:116443108-116443130 TTACATATTAATAAGGTGGAGGG - Intergenic
997066027 5:130559951-130559973 TTGTAAATAATTGAGGAGGAGGG + Intergenic
997347119 5:133200042-133200064 TTGGAAATGATTATGGAGGAAGG + Intronic
998047484 5:139000319-139000341 TTAAACATGAATAAGGATGAAGG + Intronic
999349608 5:150856787-150856809 ATGTATATGGATGAGGAAGAGGG - Intronic
1000232663 5:159330637-159330659 GTGTGTATCAATAACGAGGAGGG + Exonic
1000841198 5:166220627-166220649 TTGTCTATGAACAAGGAAGCAGG - Intergenic
1001186041 5:169573870-169573892 TTTTATAGGAACAAGAAGGAGGG - Intergenic
1005267413 6:24126431-24126453 TTATGCATGAAGAAGGAGGAAGG - Intronic
1006050168 6:31336070-31336092 TTTTAGATGACAAAGGAGGATGG + Intronic
1006264461 6:32907205-32907227 TTTTATCTGAATAGGGTGGATGG - Intergenic
1006755985 6:36415961-36415983 TTGTATATGAAACAGGAGACTGG + Intronic
1007465141 6:42046394-42046416 TGGTAGATGAGTAAGGAAGATGG - Intronic
1007987937 6:46225956-46225978 TTGTGTATAAAGTAGGAGGAAGG + Intronic
1008246455 6:49179992-49180014 TTCTAAATGCATAGGGAGGAAGG - Intergenic
1009771504 6:68148548-68148570 ATGTATTTAAATAAGGAGGCAGG - Intergenic
1010707167 6:79128456-79128478 TGGAATATGAATAAGAATGAAGG + Intergenic
1010751610 6:79621746-79621768 GTGTATATCAAGAAGGAGAATGG - Intergenic
1010768196 6:79799884-79799906 CTGTATTTGAATGAGTAGGATGG + Intergenic
1011181079 6:84621769-84621791 TTGTATATGATGAGGGAGAAGGG - Intergenic
1012060395 6:94471340-94471362 TAGTACTAGAATAAGGAGGAGGG - Intergenic
1012301173 6:97590270-97590292 AACTATATGAATAAGGAGGAAGG - Intergenic
1012978588 6:105806320-105806342 TTGTATGTGTGTAAGGAGGAAGG - Intergenic
1013277519 6:108600020-108600042 TTTTATATGTATAAGGAGGGTGG + Intronic
1014463332 6:121725631-121725653 TTGTAGATTATTAAGGAGGCAGG + Intergenic
1014540683 6:122672052-122672074 TTGTCCATCAAAAAGGAGGATGG + Intronic
1020464920 7:8466616-8466638 TAGTATATCATTAAGGAAGATGG + Intronic
1020878685 7:13730648-13730670 GTGTATAAGAAAAAGAAGGAGGG - Intergenic
1021048408 7:15952247-15952269 TTTTATATGAATAGGAAAGAAGG - Intergenic
1021209016 7:17821822-17821844 ATGGATGTGAATATGGAGGATGG - Intronic
1021377422 7:19925014-19925036 TTTTATATTAAAAAGGAGAATGG + Intergenic
1022270976 7:28807810-28807832 TTGAGAATGAAGAAGGAGGAAGG + Intronic
1022416724 7:30184741-30184763 TTGTAAATGAATGAGGGTGACGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022982317 7:35615759-35615781 TTGTATGTGAGGATGGAGGAGGG - Intergenic
1023282258 7:38583091-38583113 TTGAAAATGAATAAGCGGGATGG - Intronic
1023628594 7:42140803-42140825 TTATACAAGAAAAAGGAGGAGGG + Intronic
1027457504 7:78411835-78411857 ATTTAAATGAATAAGGAGAAAGG + Intronic
1028488005 7:91381124-91381146 TTGGATTTGAATAAAGAGAATGG - Intergenic
1028591103 7:92496261-92496283 CTGTATATGAATACAGAAGATGG - Intronic
1028715998 7:93969495-93969517 GTGGATATGAATAATCAGGAAGG + Intronic
1030115722 7:106060870-106060892 TTTTCCATGAACAAGGAGGATGG + Intergenic
1032924329 7:136585678-136585700 TAGTAAATAAAAAAGGAGGAAGG + Intergenic
1033436795 7:141340126-141340148 TTGGCTTTGAATATGGAGGAAGG + Intronic
1034696077 7:153055053-153055075 TTGGATATGGTGAAGGAGGAGGG + Intergenic
1038136106 8:24787460-24787482 TTCTATGAGCATAAGGAGGAAGG - Intergenic
1038807558 8:30809361-30809383 TTATGTATCAACAAGGAGGATGG + Intronic
1039719606 8:40149241-40149263 TTGTCTTTGAAGATGGAGGAAGG - Intergenic
1039765173 8:40620921-40620943 TTGGAAATGAATAAGCAGTAGGG - Intronic
1041428445 8:57750116-57750138 GTGTAAATAAATAATGAGGAAGG + Intergenic
1041991287 8:63995043-63995065 TTGAAGATGAATAAGTATGAAGG + Intergenic
1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG + Intergenic
1042566953 8:70121315-70121337 ATGGATATGATTAAGCAGGAGGG - Exonic
1042808480 8:72798008-72798030 TTGTATATGAAGAAGGGAAATGG - Intronic
1043058567 8:75471600-75471622 TTGGAAATTAATAAGAAGGAAGG - Intronic
1043271953 8:78345100-78345122 CTGTATATGAATTAGGAAGCAGG + Intergenic
1043347961 8:79322236-79322258 GTGTTCATGGATAAGGAGGAAGG + Intergenic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1045820161 8:106327960-106327982 TTGTATTTTAAAAAGGATGAGGG + Intronic
1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG + Intergenic
1048550176 8:135426768-135426790 TTATTTAGGAATAAGAAGGAAGG + Intergenic
1048687517 8:136920267-136920289 TTGTCTTTGAAGATGGAGGAAGG + Intergenic
1050115436 9:2258703-2258725 TGGTCTTTGGATAAGGAGGAAGG + Intergenic
1050275398 9:3992453-3992475 CTGTTTATGCATGAGGAGGAAGG - Intronic
1050501459 9:6302457-6302479 CTGTTCATGAACAAGGAGGAAGG - Intergenic
1051939098 9:22483272-22483294 TGGAATATGATTAAGGAGTAAGG - Intergenic
1051993300 9:23180418-23180440 TTATATATTGATAAGGAAGATGG - Intergenic
1053624189 9:39851944-39851966 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1053880677 9:42591284-42591306 TAGTGTATGTATGAGGAGGAGGG - Intergenic
1053891992 9:42703048-42703070 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1054219708 9:62398754-62398776 TAGTGTATGTATGAGGAGGAGGG - Intergenic
1054231007 9:62510419-62510441 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1054748637 9:68881745-68881767 TTGTCTAGGAATAAGGAAGAAGG - Intronic
1056492379 9:87120307-87120329 TTCTCTATGAAGAAGCAGGAGGG + Intergenic
1056761129 9:89415620-89415642 CTGTCTATGAACCAGGAGGAGGG + Intronic
1060359250 9:122939748-122939770 TTGTAACTGTATAAGGAGAAAGG + Intergenic
1060489501 9:124072112-124072134 GGGTAGATGAATAAGAAGGATGG + Intergenic
1060839068 9:126780177-126780199 TTGTCTATGAGACAGGAGGAGGG + Intergenic
1060874274 9:127069055-127069077 GTGCATATGAAGAAGGAGGCAGG - Intronic
1186876064 X:13819396-13819418 TTCTATATGTAGAAGTAGGATGG + Intronic
1187226473 X:17378318-17378340 TTGTACATGAATAATAAAGATGG + Intronic
1189737772 X:44089068-44089090 TTTTGGATGAAGAAGGAGGAGGG + Intergenic
1192531276 X:71888850-71888872 TTGGCTTTGAAGAAGGAGGAAGG + Intergenic
1192577906 X:72257646-72257668 TTGAAGATGATCAAGGAGGAAGG + Intronic
1193459185 X:81769984-81770006 TTATATATAAAAAAGGAGAAAGG + Intergenic
1193616977 X:83700939-83700961 TTGTATATGATTAAGAAAGGAGG + Intergenic
1194541792 X:95182175-95182197 TTTTTTATGAATAAAGAGGCTGG + Intergenic
1197189861 X:123634167-123634189 TTGTATATAAATATGGGGGAAGG + Intronic
1197195449 X:123695106-123695128 TTATATATGACTAAGAAAGAGGG - Intronic
1199229491 X:145419641-145419663 TTTTATATGGTTTAGGAGGAGGG + Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1201606992 Y:15797985-15798007 ATGTATTTGAATCAGGGGGATGG - Intergenic