ID: 967424122

View in Genome Browser
Species Human (GRCh38)
Location 3:189306661-189306683
Sequence GTAGCTCAAAATTACTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967424120_967424122 4 Left 967424120 3:189306634-189306656 CCTGTAACTACATCTATGTCTTC 0: 1
1: 0
2: 0
3: 10
4: 165
Right 967424122 3:189306661-189306683 GTAGCTCAAAATTACTATATGGG 0: 1
1: 0
2: 1
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967424122 Original CRISPR GTAGCTCAAAATTACTATAT GGG Intronic
902448037 1:16479513-16479535 TTAGCCCAAAATTAGTATTTTGG - Intergenic
906644286 1:47462671-47462693 TTTGCTCAAAATTACTATATTGG - Intergenic
907104031 1:51864220-51864242 GTATTTCAATATTAATATATTGG + Intronic
907121326 1:52010595-52010617 GTATCTAAAAATAATTATATGGG + Intergenic
911390722 1:97237861-97237883 TTAGCTCAAATTTACTCTCTTGG - Intronic
915816750 1:158975384-158975406 CTGGCTCAGAATTACTATATGGG + Intronic
918948424 1:191101236-191101258 TTATCTCAAAATTACTATGCTGG + Intergenic
919866153 1:201784533-201784555 GTAGGTAAAAACTACCATATAGG - Intronic
921391519 1:214619579-214619601 ATAGATCAAAAGGACTATATAGG - Intronic
923171824 1:231423040-231423062 GTAGCCCAAAATTTCTTCATGGG - Exonic
924391857 1:243569397-243569419 GTGGCTTAAGATTTCTATATAGG + Intronic
1063644239 10:7862811-7862833 GAATCTCAAAATAATTATATTGG - Intronic
1065465937 10:26021998-26022020 GTAGTAAAAAATTACTAGATTGG - Intronic
1065546427 10:26826190-26826212 GAAAGTCAAAATTACTCTATGGG + Intronic
1065711156 10:28519370-28519392 GAAACTCAAAATTACGACATTGG - Intergenic
1068723609 10:60275131-60275153 GTAGCTAAAAAGGAATATATGGG + Intronic
1074074201 10:110106173-110106195 TTACCTCAAAATTACTAGAGAGG - Intronic
1074809956 10:117093976-117093998 GTTTCTCAAAAATAATATATTGG - Intronic
1085702777 11:78760038-78760060 GAAAATCAAAATTACAATATTGG - Intronic
1087633579 11:100678425-100678447 GTAACTCCAAATTCCTATTTTGG - Intergenic
1087679455 11:101203203-101203225 GTAGCTCATAATAACTACAGTGG - Intergenic
1088393627 11:109343305-109343327 GTTCCTGAAAATTCCTATATAGG - Intergenic
1090111633 11:123916675-123916697 ATAGCTCAAAACAACTCTATAGG + Intergenic
1090679903 11:129043868-129043890 CCAACTAAAAATTACTATATGGG - Intronic
1091367388 11:135033496-135033518 GAAGCTCAATATTACTTTATTGG - Intergenic
1091577106 12:1748131-1748153 GAAGCTGAAAATTACAATAATGG - Intronic
1099537648 12:83864572-83864594 GTGGCTCAAATTGACTAAATGGG + Intergenic
1099837723 12:87928582-87928604 GTAGCTTAAAATGATTACATAGG - Intergenic
1099897172 12:88662722-88662744 GTAGCTGAAACTTAAGATATTGG + Intergenic
1100447345 12:94673591-94673613 GCAGTTCAGAATTACCATATGGG - Intergenic
1100790065 12:98120479-98120501 GAAGTTAAAAATTACTAAATTGG + Intergenic
1106294230 13:28395381-28395403 GTGGCTCACAGTTACCATATTGG - Intronic
1106988965 13:35393017-35393039 GTAGATCATAATTACTGAATAGG - Intronic
1107234243 13:38149661-38149683 GTATCTCAAAATGACTAGACGGG + Intergenic
1107722657 13:43265266-43265288 GCAGCTTAAGATTAATATATGGG - Intronic
1108863569 13:54894003-54894025 GTTGCTCAAAACTACTCTCTTGG + Intergenic
1109171544 13:59104189-59104211 GTAGCTGAAAAATACAAAATTGG + Intergenic
1110995907 13:82109195-82109217 GTGGCTCAAAATAAATATAGAGG + Intergenic
1111187495 13:84757981-84758003 GTTGGACAAAATTAGTATATTGG - Intergenic
1111558500 13:89912278-89912300 TTACCTCAAAATAACTATTTTGG + Intergenic
1112098356 13:96159734-96159756 GTAGCTCAAAATTAGTCAAATGG - Intronic
1112513994 13:100035974-100035996 GTATCTATAAATTGCTATATAGG - Intergenic
1115717849 14:36125477-36125499 GTAGCCCAAAGTAAGTATATTGG + Intergenic
1116573081 14:46543384-46543406 CCAGCTGAAAATTAGTATATTGG + Intergenic
1117693617 14:58336401-58336423 ATAGGTCAAAATGACTACATAGG - Intronic
1117753872 14:58953865-58953887 GTATTTCAAAATTAGTTTATAGG + Intergenic
1120086170 14:80276074-80276096 GTAGCACAAAGTCACAATATTGG - Intronic
1124909096 15:33900605-33900627 GTATTTAAAAATTACTAAATTGG - Intronic
1125006269 15:34821310-34821332 GAAGCTCAAAATCCCTATAAAGG - Intergenic
1129981500 15:79875701-79875723 GTAGCAAAAAATTATTACATAGG + Intronic
1130020425 15:80226132-80226154 GTAGCTCAAAGCTACTATGGAGG + Intergenic
1134053140 16:11151566-11151588 GTAGCTCAAAATGTCTGTTTGGG + Intronic
1137068263 16:35873785-35873807 GTAGTTCAAAAATATTAAATAGG - Intergenic
1137475497 16:48804640-48804662 GAAGCTCAAAATTCCCAAATAGG + Intergenic
1138587769 16:57982449-57982471 GTGGCTCAAATTCACCATATGGG - Intronic
1146861423 17:36303418-36303440 TTAGCTCAAAATTGTTATATTGG - Intronic
1147091754 17:38107522-38107544 TTAGCTCAAAATTGTTATATTGG - Intergenic
1147105457 17:38212978-38213000 TTAGCTCAAAATTGTTATATTGG + Intergenic
1148424044 17:47575498-47575520 TTAGCTCAAAATTGTTATATTGG - Intronic
1152040853 17:77901752-77901774 GTAGCTCAAACTTCCTCTGTTGG - Intergenic
1155642792 18:28039603-28039625 CTAGCTCACACTTACTTTATGGG + Intronic
1157033711 18:43945393-43945415 GTTGCTCCAACTTACTGTATAGG - Intergenic
926072165 2:9906018-9906040 ATAGATCAGAATTACTATTTTGG + Intronic
931871496 2:66465604-66465626 GTAGCCCAAAATTGCTACATGGG + Intronic
932703753 2:74007980-74008002 GTAGCTTTAAATTGCTATAAAGG + Intronic
933273328 2:80257188-80257210 GTAGCTCAAAATTAATAAGAAGG - Intronic
935023392 2:99253304-99253326 GTAGCTCATAATTAATCTACTGG + Intronic
937716460 2:125038459-125038481 GAAGATCAACATTACTATAATGG - Intergenic
938985961 2:136576524-136576546 GTAGCTAACAACTACTGTATTGG - Intergenic
940284393 2:152019199-152019221 GTGGTTGAAAATTACTATCTGGG - Intronic
941382359 2:164809505-164809527 ATAGCTCAAAATTACAGAATTGG + Intronic
941825731 2:169893859-169893881 GTAACTAAAAATTATAATATAGG - Intronic
942839647 2:180344499-180344521 GCAGTTAAAAATAACTATATTGG + Intergenic
946275255 2:218626921-218626943 GGAGCTCACAGTTACTATAATGG - Intronic
1174441446 20:50558502-50558524 GTAGCTCAGGGTTACTGTATTGG + Intronic
1177672081 21:24245661-24245683 GAAGGTAATAATTACTATATGGG - Intergenic
1184905374 22:47481831-47481853 GATGCTCAACGTTACTATATTGG + Intronic
949181583 3:1137481-1137503 GCAGCTCTTTATTACTATATAGG - Intronic
951114349 3:18842404-18842426 GTAGTTCATAACTACTGTATTGG - Intergenic
952974149 3:38679891-38679913 GGAGGTCAAAATTACTGCATGGG + Intergenic
957773036 3:84719066-84719088 GTAGGTCAAATATAATATATTGG - Intergenic
957791520 3:84947517-84947539 GTTGCTCAAAATTCCTTTTTGGG + Intergenic
961959541 3:130840205-130840227 GTAGCTCAAAATGACAGCATGGG - Intergenic
966057446 3:175712855-175712877 GGAGCTCCAAATTACTATGAGGG + Intronic
966112735 3:176422658-176422680 GTTGCTCAAAATAAGAATATAGG + Intergenic
967424122 3:189306661-189306683 GTAGCTCAAAATTACTATATGGG + Intronic
971840864 4:31850411-31850433 GCAGTTCCAATTTACTATATTGG - Intergenic
971896248 4:32599607-32599629 GTAGCTAAAAATTACCGTACTGG - Intergenic
973716221 4:53679299-53679321 GTAGCTTAAATTTATTATACTGG + Intronic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
978691490 4:111518127-111518149 TTTGCTCAAAATTAGTATTTGGG + Intergenic
978747920 4:112215156-112215178 GTAACTGACAATTACTATATTGG - Intergenic
979188563 4:117830351-117830373 GTTTCTCAAAATTATTATTTTGG + Intergenic
979483332 4:121243127-121243149 GTGGCTCAAAATTACCTTAGTGG - Intergenic
979586571 4:122426189-122426211 GAAGCTTAAAATTATTATAAGGG + Intronic
983536599 4:168863584-168863606 GTCTTTCAAAATTACTATGTAGG - Intronic
983999795 4:174226130-174226152 GTAGCTCAAAATTCCTGCAGGGG - Intergenic
984003945 4:174285751-174285773 GAAGCTCAGACCTACTATATTGG + Intronic
984428501 4:179618678-179618700 GTAGCTCTAAAATAATATATTGG + Intergenic
986937069 5:12902180-12902202 GTAGTTTAAAATGACTATACTGG - Intergenic
988062530 5:26191362-26191384 GTATCTCAAAATTACAAAGTTGG - Intergenic
988311738 5:29567820-29567842 GTAGTTCAAAATTAAGGTATTGG - Intergenic
988691297 5:33575545-33575567 GAAGCTAAAAATTTATATATAGG - Intronic
989093843 5:37762804-37762826 ACAGCTCAAAATTACTTTCTAGG - Intergenic
991358870 5:65799180-65799202 GTTTCTTAAAATAACTATATAGG - Intronic
991909466 5:71547374-71547396 TTAGGGCAAGATTACTATATAGG + Intronic
993419219 5:87679691-87679713 GAATCTCAAAATTATTATACTGG + Intergenic
994410370 5:99400600-99400622 GTAACTCAATAATACTAAATAGG - Intergenic
997374356 5:133386436-133386458 GTTTCTCTAAATTAGTATATGGG + Intronic
997797074 5:136820971-136820993 GTAGCTCAGAAGTTCTATGTTGG + Intergenic
999648461 5:153742467-153742489 GTAGCTCAAAAGTCCAGTATGGG + Intronic
1001302508 5:170545659-170545681 ATAGTACAAACTTACTATATGGG - Intronic
1004538968 6:16531073-16531095 GTATCTCAAAATTCCCAAATTGG + Intronic
1004803362 6:19175303-19175325 GTAGCACTAACTTACTTTATAGG - Intergenic
1004852177 6:19711395-19711417 GTAGCTCAAAATGATGCTATTGG - Intergenic
1007884113 6:45206041-45206063 ATAGCTAAAAATTAATATAATGG - Intronic
1008053364 6:46922375-46922397 GTACCTCAAAAATGCCATATTGG + Intronic
1008693172 6:54003912-54003934 GTAGCTCAAAAATGCAATAATGG - Intronic
1009269046 6:61595644-61595666 ACAGCTCAAAATTACTTTCTAGG - Intergenic
1011978867 6:93345813-93345835 GTAGCTCTAATTTACTGCATTGG + Intronic
1012095967 6:94961383-94961405 GTAGATTAGAATTACTATTTGGG + Intergenic
1012591633 6:100988609-100988631 GAATCTGAAAATTACTAAATAGG + Intergenic
1012697546 6:102407178-102407200 CTTGCTCAAAATCACTCTATTGG - Intergenic
1012782267 6:103577695-103577717 GTAACTCAGAATTTCTAAATAGG + Intergenic
1012906715 6:105075366-105075388 GTAGCTGAACATTTCTATTTTGG + Intronic
1013695456 6:112697676-112697698 GGATCTCTAAATTACCATATGGG - Intergenic
1013992877 6:116275172-116275194 GTGGCTAAAAGTTACTGTATTGG + Intronic
1017034508 6:150255134-150255156 GTAGCACAAAATTACTCCTTTGG + Intergenic
1018737811 6:166701963-166701985 TTAGCTCAAAATAACTTTGTTGG - Intronic
1020858966 7:13464011-13464033 GTATTTCAAAATTATTTTATTGG - Intergenic
1022306247 7:29149153-29149175 GTTGTTCAAAATTAGTAGATTGG + Intronic
1022397919 7:30007563-30007585 GTGCCTCAAAATGAGTATATAGG - Intergenic
1024476796 7:49820472-49820494 GTTCCTCAAAATTAGAATATTGG - Intronic
1027970823 7:85078832-85078854 GTAGGTAAAAATTACTAGAGAGG + Intronic
1028040696 7:86049779-86049801 GTAGCTCAAAATAAAGAAATTGG + Intergenic
1028197672 7:87926310-87926332 GTAGCTAGTAACTACTATATTGG - Intergenic
1031188934 7:118521205-118521227 GTATCTCAAAATTGCTTGATAGG - Intergenic
1031431830 7:121680973-121680995 GTAGCACAAAATCACTAAAAAGG + Intergenic
1032554019 7:132812762-132812784 GTAGGTCATAATCACTATTTTGG - Intronic
1034019287 7:147624391-147624413 GGAGCTCAAAATAACTCTATAGG + Intronic
1038470838 8:27818012-27818034 GCAGCTCATAACTACTGTATTGG + Intronic
1043449900 8:80356018-80356040 TCAGCTCAGAGTTACTATATTGG + Intergenic
1044875712 8:96664288-96664310 GGAGCTCAGAATGACTCTATAGG + Intronic
1046816412 8:118588951-118588973 GAAGCTTAAAATTTCTATAGAGG + Intronic
1047585908 8:126272250-126272272 GAAGCTCAAAATTATGATTTAGG - Intergenic
1048192689 8:132304495-132304517 GTTGCTCTAAATAACTCTATAGG - Intronic
1048429659 8:134358307-134358329 GGAGGACATAATTACTATATGGG - Intergenic
1048716256 8:137273651-137273673 GTAGTGCAAAATTACTATGCTGG + Intergenic
1050385338 9:5084025-5084047 TTAACTCAAAATTACAATAAAGG - Intronic
1050776098 9:9262495-9262517 GTAGCTAAAGGCTACTATATTGG + Intronic
1052417511 9:28196407-28196429 GTTGCTCAAAATTAGCATATTGG + Intronic
1053588784 9:39488765-39488787 GTACCTCTAAATTAATATACTGG - Intergenic
1054577519 9:66876529-66876551 GTACCTCTAAATTAATATACTGG + Intronic
1061115719 9:128610259-128610281 GTAGCTCAAAGTTACTTAAGCGG + Intronic
1194106636 X:89777776-89777798 ATATCTCAATATTAATATATGGG + Intergenic
1197538305 X:127721284-127721306 ATAGCACAAAATTACTCTCTTGG + Intergenic
1200458600 Y:3425640-3425662 ATATCTCAATATTAATATATGGG + Intergenic