ID: 967424919

View in Genome Browser
Species Human (GRCh38)
Location 3:189316125-189316147
Sequence GTGCATATGTTCAGAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967424919 Original CRISPR GTGCATATGTTCAGAGAGGA GGG Intronic
900851768 1:5149256-5149278 GTCCATATATTCAGAAAGGTTGG + Intergenic
901206386 1:7498803-7498825 GTACATGTGTGTAGAGAGGATGG + Intronic
902330586 1:15729327-15729349 CTGCATCTGCTCAGAGAGGCAGG + Intronic
903357868 1:22759127-22759149 GGGAAAATGTTCCGAGAGGAAGG - Intronic
903826287 1:26147854-26147876 GTGCATCTGGACAGGGAGGATGG + Intergenic
905640425 1:39585832-39585854 GTGCATGTGTCTAGTGAGGAAGG + Intergenic
908620288 1:65971689-65971711 CTGAAAATATTCAGAGAGGATGG + Intronic
908815336 1:68026414-68026436 GCACATATCTTCAGAGAGGTTGG - Intergenic
912189299 1:107318929-107318951 CTGTATATCTTCAGACAGGAAGG - Intronic
912302585 1:108533511-108533533 GTGCAAAGGGTCAGTGAGGAGGG - Intergenic
912892159 1:113545588-113545610 TTGCATATATTCAGAAAGTATGG + Intronic
912951983 1:114126579-114126601 GTGCATATGCTCTGGGAGCAAGG + Intronic
913265125 1:117036002-117036024 GTCCATGTGAGCAGAGAGGAGGG - Intronic
914983527 1:152437404-152437426 GTTCATAAGTTCAAAGAGAATGG - Intergenic
916398954 1:164424654-164424676 GTGCATTTGATCAGACATGAGGG - Intergenic
917281703 1:173383285-173383307 GTGCATGTGTTCAGAGAAATAGG + Intergenic
918663721 1:187121293-187121315 GTGCCTAATTTCAGAGAAGAGGG - Intergenic
921270400 1:213463735-213463757 GGGCAGAGTTTCAGAGAGGAGGG - Intergenic
921715529 1:218413483-218413505 GTGCATTTCTACAGAGAGGCAGG + Intronic
921965699 1:221086479-221086501 GTGCATATGGACAGAGAGATTGG + Intergenic
922976727 1:229791108-229791130 GTTGATATGTTTAGAGTGGAAGG - Intergenic
1063263949 10:4424501-4424523 GTACATATGTGCAGAGAGAAGGG - Intergenic
1068159031 10:53239822-53239844 CTGCAGAGTTTCAGAGAGGAAGG - Intergenic
1069635027 10:69919834-69919856 GTGCATGTGTTCCGAGATGAGGG + Intronic
1070467434 10:76737753-76737775 GTGCAAAGCTTCAGAGAGGATGG + Intergenic
1070595727 10:77831668-77831690 GTGCATAAGTTAACAGAGGAAGG + Intronic
1071982636 10:91019109-91019131 GTGGCTAAATTCAGAGAGGAGGG + Intergenic
1072035392 10:91558584-91558606 AAGCAGATGTTCAGAGAGGTAGG + Intergenic
1073803760 10:107072524-107072546 GTGTGTATATTCAGAGAGCAGGG - Intronic
1076165660 10:128280554-128280576 GTACATGTGGGCAGAGAGGATGG - Intergenic
1077015095 11:395823-395845 GTGGATGGGTGCAGAGAGGATGG - Intronic
1078023213 11:7672379-7672401 GTGTTTCTGTTAAGAGAGGAGGG + Intronic
1079954901 11:26850376-26850398 GTGGACATGGTGAGAGAGGAGGG - Intergenic
1084861059 11:72018508-72018530 GTGCATCTGCCCAGAGTGGAGGG + Exonic
1085235567 11:75012307-75012329 ATGCATAGGTTCATTGAGGAAGG - Intronic
1089280884 11:117373570-117373592 GTGCACATGTCCAGAGAGAATGG + Intronic
1089360438 11:117882558-117882580 GTGCATATTTGCAGAGAGGAGGG - Intergenic
1090004742 11:122991412-122991434 GTGTATGTGTTCAGAGGTGATGG - Intergenic
1090111762 11:123918399-123918421 GTACACATCTTCAGAGAGGAGGG + Intergenic
1090315700 11:125785992-125786014 GAGCATCTATTCAGAGTGGAGGG + Intergenic
1090478728 11:127048892-127048914 ATGCATATGTTGAGATAGAAGGG - Intergenic
1091917094 12:4277509-4277531 GTTCATTTGTTTCGAGAGGATGG + Intronic
1093381286 12:18497005-18497027 TTGCATATGTCCAAAGGGGAAGG - Intronic
1095208660 12:39467665-39467687 ATGCTTATGTTTAGTGAGGAAGG + Intergenic
1095974156 12:47927863-47927885 ATGTATATGTTCAGAGTGGTGGG + Intronic
1096300204 12:50420424-50420446 GTGAATATTTTAAGAGAGAATGG + Intronic
1097790135 12:63806781-63806803 GTGCATGATTTCAGAGAGTAAGG - Intronic
1099096859 12:78384993-78385015 TTCCATATGGTGAGAGAGGAGGG + Intergenic
1103516281 12:121510257-121510279 GTGCCAGTGTTCAGAGAGGCGGG - Intronic
1104323494 12:127774021-127774043 TTGCAATTGTTCAGATAGGAGGG - Intergenic
1104481305 12:129110622-129110644 GTGCATAAGTAAGGAGAGGAGGG + Intronic
1107829917 13:44365365-44365387 GTGCTGATGTTCAGAAAGGCTGG + Intergenic
1107854771 13:44603955-44603977 CTGCATATGTTCACATGGGATGG - Intergenic
1108381432 13:49858346-49858368 ATGCTTATGCACAGAGAGGAAGG + Intergenic
1109913522 13:68948816-68948838 GTGTGTATGTTTAGGGAGGAGGG + Intergenic
1110723679 13:78794939-78794961 GTGCAAATGTTCAGGGAAGTGGG + Intergenic
1110723726 13:78795357-78795379 GTGCAAATGTTCAGGGAAGTGGG - Intergenic
1112136352 13:96582777-96582799 ATGCATATGTAAATAGAGGATGG - Intronic
1117359431 14:54958700-54958722 GTCCACAGGTCCAGAGAGGAAGG - Intronic
1118387746 14:65270452-65270474 GTGCATATGGGGAGATAGGAAGG - Intergenic
1118707757 14:68495641-68495663 GGGCATATGAGCAGAGAGGAAGG - Intronic
1118863408 14:69683442-69683464 ATGCTTTTGTTTAGAGAGGAAGG + Intronic
1119900654 14:78256818-78256840 GGGAATTTGTTCAGAGAGGGTGG + Intronic
1120067678 14:80063065-80063087 GGGCAGATGTCCAGAGAAGAGGG - Intergenic
1120093239 14:80358515-80358537 AGGCATATGGTCAGAGAGAAAGG + Intronic
1120977762 14:90264586-90264608 GGGCATATGGTCATTGAGGATGG + Intronic
1121180713 14:91926412-91926434 GTACATGTGTCCACAGAGGATGG + Intronic
1121814245 14:96916842-96916864 ATGCATATGAACAGAGAGGGGGG + Intronic
1124127191 15:26946714-26946736 GTGGATATGTTTGGAGAGGTGGG - Intronic
1124640742 15:31394589-31394611 GTGGATATGGGCAGAGAGGATGG + Intronic
1127372439 15:58354113-58354135 CAGAATTTGTTCAGAGAGGAGGG - Intronic
1127667839 15:61166368-61166390 GTGAATCTGTTTAGAGAGGAGGG + Intronic
1128542264 15:68544351-68544373 GTCCATGTGTGCAGAGTGGATGG - Intergenic
1128759472 15:70206096-70206118 GTAATTATTTTCAGAGAGGAAGG + Intergenic
1130832855 15:87619355-87619377 GTGCAAAAGTTCAAAGGGGAAGG + Intergenic
1134422196 16:14104215-14104237 GTGTATTTATTCAGATAGGAAGG + Intronic
1134904396 16:17967645-17967667 GTGGATATGTTCATGGAAGACGG - Intergenic
1135818892 16:25661603-25661625 CTGTATATATTCAGGGAGGAAGG - Intergenic
1137386353 16:48046288-48046310 TTGCATATATACAGATAGGAGGG + Intergenic
1138043089 16:53695525-53695547 GTGCCTATTTTCTGAGGGGAAGG - Intronic
1138054748 16:53820911-53820933 GCACATATGGTCAGAGAGAAAGG + Intronic
1141013311 16:80423708-80423730 TTTCCTATGTTGAGAGAGGAGGG - Intergenic
1143272613 17:5686971-5686993 GTGCAGATGCTCAGAGAGGAAGG + Intergenic
1143578289 17:7807986-7808008 GTGCATATGTTGTGTGGGGACGG + Intronic
1144667217 17:17110169-17110191 GATCACATGGTCAGAGAGGAGGG - Intronic
1149684698 17:58528701-58528723 GTGGATTTGTGCAGAGAGGCAGG - Intronic
1151378032 17:73705020-73705042 GTGCATTGGTCCAGAGAGGTTGG + Intergenic
1152582004 17:81169882-81169904 GTGCATATGTGCATAGAGGTAGG + Intergenic
1152732725 17:81980553-81980575 GTTCATATGTTTGGAAAGGAGGG + Intronic
1153452960 18:5249966-5249988 GTGCATACGTTTGGAGATGAGGG + Intergenic
1157135129 18:45046542-45046564 GTGTATTTATTCAGAGAAGAAGG + Intronic
1158352144 18:56573774-56573796 GGGCATAGATTCAGGGAGGACGG + Intergenic
1159998701 18:74994613-74994635 GTCCATCTGTGCAGAGAGCAGGG + Intronic
1162364874 19:10242550-10242572 GGGCAGATTTTCCGAGAGGAAGG - Intergenic
1163187024 19:15645954-15645976 GTGCCCATGTGCAGACAGGAGGG + Intronic
1167382267 19:49145594-49145616 GTGCAAATGTTTAGGGAGTATGG - Intronic
1167560779 19:50225762-50225784 GTGGATCTGTTGAGGGAGGAGGG + Intronic
925317235 2:2935854-2935876 GTGCAGATGTTTAGTGAGGTCGG - Intergenic
925363325 2:3294769-3294791 GTGTGTATGTAGAGAGAGGATGG - Intronic
925363376 2:3295015-3295037 GTGTATGTGTGCAGAGAGTATGG - Intronic
925363413 2:3295220-3295242 GTGTATGTGTGGAGAGAGGACGG - Intronic
925363456 2:3295420-3295442 GTGTGTGTGTGCAGAGAGGATGG - Intronic
925363470 2:3295486-3295508 GTGTATGTGTGCAGAGAGGATGG - Intronic
925363602 2:3296128-3296150 GTGTGTGTGTGCAGAGAGGATGG - Intronic
925363704 2:3296614-3296636 GTGTATGTGTGTAGAGAGGATGG - Intronic
926104271 2:10140714-10140736 GTACATATGGATAGAGAGGAAGG + Intergenic
926722830 2:15974645-15974667 GAGCACAGGTGCAGAGAGGAGGG - Intergenic
927056035 2:19366242-19366264 TTGCATATGTGGAAAGAGGAGGG + Intergenic
930025512 2:47026979-47027001 GTGAACATGTTCAGAGGGGAGGG + Intronic
932307946 2:70717080-70717102 GTTCCTCTGTGCAGAGAGGAGGG - Intronic
933447486 2:82400854-82400876 GTGCATATGGTCACAAAGAAGGG - Intergenic
935459805 2:103316991-103317013 GTGCATATGGTCACAAAGAAAGG - Intergenic
935675984 2:105595336-105595358 GGGCTTATGCACAGAGAGGAAGG - Intergenic
936832807 2:116669584-116669606 ATGCATATGTGCAGAGCTGAGGG - Intergenic
937048284 2:118864740-118864762 GAGCATCTGTTCTGAGTGGAAGG - Intergenic
938600903 2:132838066-132838088 GTGAATAAGTTGAAAGAGGAGGG - Intronic
938995492 2:136673554-136673576 GTGGATATGTGCAGTGAGGGGGG + Intergenic
941427195 2:165362849-165362871 GTGCATATGGTGAGTGAAGATGG + Intronic
941683224 2:168421344-168421366 GGGAATATGTTCAGAGAGAGTGG + Intergenic
941867492 2:170349959-170349981 GTGTGTATATTGAGAGAGGAAGG - Intronic
942391375 2:175497132-175497154 TTGCATATGGTGAGAGAGAAGGG + Intergenic
943040004 2:182793128-182793150 GAGCATATGAACAGAGAGAAAGG + Exonic
943112866 2:183627535-183627557 GTGCACATGTTGATATAGGAGGG + Intergenic
943889574 2:193269852-193269874 ATGCATATTTTCATAGAGGAAGG + Intergenic
945420427 2:209629495-209629517 GTATTTATTTTCAGAGAGGATGG - Intronic
946034186 2:216728693-216728715 GTGCATAGTTTCAGAATGGATGG + Intergenic
946113305 2:217438908-217438930 GTTCATAACTTCACAGAGGAAGG + Intronic
1169766637 20:9154134-9154156 GTGCACATGTGCAGCGAGGAGGG + Intronic
1170826102 20:19797260-19797282 CTGCATATTCTAAGAGAGGAAGG - Intergenic
1172066727 20:32226589-32226611 GTGTATATGTTTAGGGAGGTGGG - Intronic
1172470527 20:35190824-35190846 CTACATATGTTCAAAGATGATGG + Intergenic
1175077842 20:56391209-56391231 GTGCATGTCTGCAGAGATGAAGG + Intronic
1180785123 22:18542850-18542872 GTGCAGATGTTCACAGCGGCTGG - Intergenic
1181128706 22:20716889-20716911 GTGCAGATGTTCACAGCGGCTGG - Intronic
1181242026 22:21482204-21482226 GTGCAGATGTTCACAGCGGCTGG - Intergenic
1181308813 22:21932635-21932657 GTGGCTAAGTTCACAGAGGAGGG + Intronic
954594170 3:51811147-51811169 GTGATTATGTTCAGTCAGGAAGG - Intergenic
959687380 3:109162576-109162598 CTACATCTGTGCAGAGAGGAGGG + Intergenic
961092531 3:124126772-124126794 CTCCATATGTTCACAGATGAGGG + Intronic
963740009 3:149069018-149069040 GTGCAGATGTTAACAGAGTAAGG - Intronic
963818465 3:149860588-149860610 TTGTATATGGTCAGAGATGAGGG - Intronic
965902174 3:173655823-173655845 GTGCATATGTTACCAGTGGATGG + Intronic
967424919 3:189316125-189316147 GTGCATATGTTCAGAGAGGAGGG + Intronic
967425099 3:189317854-189317876 CTGCATGTGTTCAGAGAGGAGGG + Intronic
968933236 4:3595478-3595500 GGGCAGAGGATCAGAGAGGAGGG - Intergenic
970112129 4:12650639-12650661 GTGCATTTGGTCACAGATGAGGG + Intergenic
970435101 4:16025676-16025698 ATGCATATGTTCACACAGGAGGG - Intronic
972704556 4:41529331-41529353 GTGCATATGTGCACACACGACGG - Intronic
976194621 4:82520937-82520959 GTGCGTAAAGTCAGAGAGGAAGG - Intronic
976415339 4:84767477-84767499 ATGATTAAGTTCAGAGAGGAAGG + Intronic
977737177 4:100431079-100431101 GTGAATATGCTCAGACAGGATGG + Intronic
978106654 4:104910808-104910830 ATTGATATTTTCAGAGAGGAAGG - Intergenic
978910695 4:114060271-114060293 GTGCATGTGATCACAGAGGTCGG + Intergenic
979155893 4:117390433-117390455 GTAGATATGTTCTGAGAGAAAGG + Intergenic
981566710 4:146109319-146109341 GGGCTTATTTTCAAAGAGGAAGG - Intergenic
981648928 4:147033886-147033908 ATGCACATGTTAAGGGAGGAAGG + Intergenic
982339668 4:154283945-154283967 CTGCATGTGTTCAGAAAGAAAGG + Intronic
984622801 4:181973165-181973187 CTGCATATGTTATAAGAGGAAGG - Intergenic
984669122 4:182462480-182462502 GTGCGGCTGTTCAGAGAGGAGGG - Intronic
987144054 5:14974450-14974472 GTGATTACCTTCAGAGAGGAGGG + Intergenic
987550998 5:19381436-19381458 GTTTATGTCTTCAGAGAGGATGG + Intergenic
989548270 5:42699923-42699945 ATGCAGATATTCAGAAAGGATGG + Exonic
990773391 5:59276935-59276957 GTGTAGATGTTCAGAGAGATAGG - Intronic
991650172 5:68844624-68844646 ATGCAGATCCTCAGAGAGGAAGG - Intergenic
992372174 5:76154459-76154481 GTGCATTTATTCAATGAGGATGG + Intronic
993532660 5:89043267-89043289 TTGCATATGTTTGGGGAGGAGGG + Intergenic
995362287 5:111311038-111311060 GAGCTTATTTTCAGAGAGAATGG + Intronic
996264989 5:121528996-121529018 GTTCAGATATTCAAAGAGGAGGG - Intergenic
996777823 5:127152048-127152070 GTGGAAAAGTTCAAAGAGGAAGG + Intergenic
998472648 5:142395306-142395328 TTGCATTTGTGCTGAGAGGAAGG + Intergenic
1001735967 5:174001752-174001774 GTGAATATGTAAAGAGAGAATGG - Intronic
1004226385 6:13788319-13788341 ATGCATATCTGGAGAGAGGAGGG - Exonic
1006579285 6:35067304-35067326 GTGCATGGGCCCAGAGAGGAGGG - Intronic
1006598274 6:35209271-35209293 GTGGATGTGGGCAGAGAGGAGGG + Intergenic
1007501549 6:42301840-42301862 GCTGATATGTTCAGAGAGGGAGG + Intronic
1007820883 6:44559826-44559848 GGGCACAAGTTCAGAGAGGGAGG - Intergenic
1007994175 6:46288560-46288582 TTGAATATGTTTAGATAGGAGGG - Intronic
1011234189 6:85197729-85197751 ATGCATATGTGCAGAAAGAATGG + Intergenic
1012037300 6:94158905-94158927 GTGCATATGGGCTGTGAGGAGGG - Intergenic
1015455376 6:133421168-133421190 GTGCATCTGCTTAGAGAGAAAGG - Intronic
1016984846 6:149887378-149887400 GTGAATATGCTGAGATAGGAAGG - Intronic
1019576512 7:1740206-1740228 GTGCAGATGGGCTGAGAGGAAGG + Intronic
1021323961 7:19244385-19244407 GTGCATATGCTCTGTGAGGTAGG + Intergenic
1023416224 7:39935508-39935530 TTGCAGAGGTTCAGGGAGGAAGG - Intergenic
1030308381 7:108042975-108042997 GTGTATGTGTACAGAGAGTAAGG + Intronic
1030968998 7:116030691-116030713 GTGCATATGTTATGGGAAGAGGG - Exonic
1031260400 7:119511199-119511221 TTGCATATGGTGAGAGATGAGGG - Intergenic
1031515070 7:122690365-122690387 GTACATATGTTCCCGGAGGAGGG + Intronic
1033141907 7:138834815-138834837 GTGCAGATGTCCTGTGAGGAGGG - Intronic
1035415826 7:158684912-158684934 GTGCAGAGGAGCAGAGAGGATGG + Intronic
1036973624 8:13383359-13383381 TTGCATATGTTCAGAGAAAGAGG + Intronic
1037258766 8:16983874-16983896 GTCCATATTTTCCGAGATGAAGG - Intergenic
1037715128 8:21391218-21391240 CTGAATATGAGCAGAGAGGAGGG - Intergenic
1038835482 8:31116704-31116726 GTGCTTAGGTGCACAGAGGAGGG + Intronic
1039954189 8:42194859-42194881 GTGCATATTTGCAGGAAGGAGGG + Intronic
1041895200 8:62916693-62916715 TTGCAGATTTGCAGAGAGGAAGG + Intronic
1045833299 8:106490534-106490556 GTGCATATTTTTAGGGAAGATGG + Intronic
1046362993 8:113186252-113186274 GGCCATATGGTCAGGGAGGAGGG - Intronic
1046424306 8:114026488-114026510 GCCCATATGTTCAGTGAGGGAGG - Intergenic
1046446853 8:114332641-114332663 GTGCAAATGTTCCTAGATGATGG - Intergenic
1047018628 8:120750708-120750730 GCTCATTTGTTCAGAGAAGAAGG + Intronic
1047252702 8:123192723-123192745 CTGCATCTGTGCAGAGGGGAAGG - Intronic
1049397967 8:142410568-142410590 GTGCAGATGTGAAGAGAGGTGGG - Intergenic
1049404307 8:142444906-142444928 GTGCAGATGTTGAGGAAGGATGG - Intergenic
1049774765 8:144399122-144399144 GGGCACCTCTTCAGAGAGGAAGG + Exonic
1052208642 9:25873659-25873681 TTGCATATGTTGAGAGAGAGGGG + Intergenic
1054456895 9:65436331-65436353 GGGCAGAGGATCAGAGAGGAGGG + Intergenic
1056711571 9:88995977-88995999 TTGCATATATTCAGAGAGCTTGG - Exonic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057615664 9:96587585-96587607 GTGAATATGTACACAGAGGTTGG + Intronic
1059343812 9:113615131-113615153 GAGCATATTTTTAGAGAGAAGGG - Intergenic
1059635038 9:116162052-116162074 TTGCAAGTGTACAGAGAGGAGGG - Intronic
1060078453 9:120617501-120617523 GGGCATAAGGTCAGAGAGAAAGG + Intronic
1060680703 9:125560900-125560922 GTTGATCTGTTCAAAGAGGATGG + Intronic
1061294527 9:129669712-129669734 GTGCATCTGTTCATAGGGGTGGG + Intronic
1061882961 9:133577201-133577223 CTACATATCTACAGAGAGGATGG + Intergenic
1187714812 X:22092298-22092320 GTGCATATGTTAGGAGAGGGTGG - Intronic
1189260963 X:39678587-39678609 GTCCAGATGTCCAGAGGGGATGG - Intergenic
1191895229 X:65985819-65985841 GAGGATATGTTCAGAGACTAGGG + Intergenic
1196717024 X:118822057-118822079 GCACATATGCACAGAGAGGATGG + Intergenic
1197394027 X:125903708-125903730 GTGCATCTGTGCAGAGATTATGG - Intergenic
1197484360 X:127029321-127029343 GTGCACATGTTTGGAGATGAGGG + Intergenic
1198050458 X:132947059-132947081 CTGCATATGATCAGATAGTATGG + Intronic