ID: 967431512

View in Genome Browser
Species Human (GRCh38)
Location 3:189391417-189391439
Sequence AAAAGATATCTGGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967431512_967431516 14 Left 967431512 3:189391417-189391439 CCACACCTGGCCAGATATCTTTT No data
Right 967431516 3:189391454-189391476 TCATAGTTTCTAGTCTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967431512 Original CRISPR AAAAGATATCTGGCCAGGTG TGG (reversed) Intergenic
No off target data available for this crispr