ID: 967436885

View in Genome Browser
Species Human (GRCh38)
Location 3:189457546-189457568
Sequence GGTCAACTCCACCGCAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967436879_967436885 14 Left 967436879 3:189457509-189457531 CCACAGGAATCTGATCTAGGCCA No data
Right 967436885 3:189457546-189457568 GGTCAACTCCACCGCAGAGAGGG No data
967436881_967436885 -6 Left 967436881 3:189457529-189457551 CCATAGTAAGTCCCAGAGGTCAA No data
Right 967436885 3:189457546-189457568 GGTCAACTCCACCGCAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967436885 Original CRISPR GGTCAACTCCACCGCAGAGA GGG Intergenic
No off target data available for this crispr