ID: 967438384

View in Genome Browser
Species Human (GRCh38)
Location 3:189477796-189477818
Sequence GTGCTAGGGATCCCTCTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967438384_967438387 -4 Left 967438384 3:189477796-189477818 CCGCAGAGAGGGATCCCTAGCAC No data
Right 967438387 3:189477815-189477837 GCACCACCATAGATACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967438384 Original CRISPR GTGCTAGGGATCCCTCTCTG CGG (reversed) Intergenic