ID: 967440752

View in Genome Browser
Species Human (GRCh38)
Location 3:189505623-189505645
Sequence CCTGAAGGGTTCCCAAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967440752_967440756 -10 Left 967440752 3:189505623-189505645 CCTGATTTTGGGAACCCTTCAGG No data
Right 967440756 3:189505636-189505658 ACCCTTCAGGGCACACCTGGAGG No data
967440752_967440760 10 Left 967440752 3:189505623-189505645 CCTGATTTTGGGAACCCTTCAGG No data
Right 967440760 3:189505656-189505678 AGGTCAGTATTTATTTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967440752 Original CRISPR CCTGAAGGGTTCCCAAAATC AGG (reversed) Intergenic
No off target data available for this crispr