ID: 967441030

View in Genome Browser
Species Human (GRCh38)
Location 3:189509237-189509259
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967441026_967441030 6 Left 967441026 3:189509208-189509230 CCTTAGGGTTCTCTTTGATTTAT No data
Right 967441030 3:189509237-189509259 CTCTGTAAGTTATGCTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr