ID: 967441934

View in Genome Browser
Species Human (GRCh38)
Location 3:189518192-189518214
Sequence TTGATTCTTGGGCCTCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967441934_967441945 22 Left 967441934 3:189518192-189518214 CCACTAGGAGGCCCAAGAATCAA No data
Right 967441945 3:189518237-189518259 GAACCAGGGTGAGCTGCTACGGG No data
967441934_967441944 21 Left 967441934 3:189518192-189518214 CCACTAGGAGGCCCAAGAATCAA No data
Right 967441944 3:189518236-189518258 AGAACCAGGGTGAGCTGCTACGG No data
967441934_967441941 8 Left 967441934 3:189518192-189518214 CCACTAGGAGGCCCAAGAATCAA No data
Right 967441941 3:189518223-189518245 ACCCACTAACATTAGAACCAGGG No data
967441934_967441940 7 Left 967441934 3:189518192-189518214 CCACTAGGAGGCCCAAGAATCAA No data
Right 967441940 3:189518222-189518244 GACCCACTAACATTAGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967441934 Original CRISPR TTGATTCTTGGGCCTCCTAG TGG (reversed) Intergenic
No off target data available for this crispr