ID: 967441937

View in Genome Browser
Species Human (GRCh38)
Location 3:189518204-189518226
Sequence GGGTCCTAAGGGTTGATTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967441937_967441948 23 Left 967441937 3:189518204-189518226 CCAAGAATCAACCCTTAGGACCC No data
Right 967441948 3:189518250-189518272 CTGCTACGGGACTTAAAAATGGG No data
967441937_967441940 -5 Left 967441937 3:189518204-189518226 CCAAGAATCAACCCTTAGGACCC No data
Right 967441940 3:189518222-189518244 GACCCACTAACATTAGAACCAGG No data
967441937_967441941 -4 Left 967441937 3:189518204-189518226 CCAAGAATCAACCCTTAGGACCC No data
Right 967441941 3:189518223-189518245 ACCCACTAACATTAGAACCAGGG No data
967441937_967441944 9 Left 967441937 3:189518204-189518226 CCAAGAATCAACCCTTAGGACCC No data
Right 967441944 3:189518236-189518258 AGAACCAGGGTGAGCTGCTACGG No data
967441937_967441945 10 Left 967441937 3:189518204-189518226 CCAAGAATCAACCCTTAGGACCC No data
Right 967441945 3:189518237-189518259 GAACCAGGGTGAGCTGCTACGGG No data
967441937_967441947 22 Left 967441937 3:189518204-189518226 CCAAGAATCAACCCTTAGGACCC No data
Right 967441947 3:189518249-189518271 GCTGCTACGGGACTTAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967441937 Original CRISPR GGGTCCTAAGGGTTGATTCT TGG (reversed) Intergenic
No off target data available for this crispr