ID: 967441939

View in Genome Browser
Species Human (GRCh38)
Location 3:189518216-189518238
Sequence TCTAATGTTAGTGGGTCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967441939_967441951 25 Left 967441939 3:189518216-189518238 CCTTAGGACCCACTAACATTAGA No data
Right 967441951 3:189518264-189518286 AAAAATGGGCACATCTGGCTGGG No data
967441939_967441952 29 Left 967441939 3:189518216-189518238 CCTTAGGACCCACTAACATTAGA No data
Right 967441952 3:189518268-189518290 ATGGGCACATCTGGCTGGGTTGG No data
967441939_967441948 11 Left 967441939 3:189518216-189518238 CCTTAGGACCCACTAACATTAGA No data
Right 967441948 3:189518250-189518272 CTGCTACGGGACTTAAAAATGGG No data
967441939_967441947 10 Left 967441939 3:189518216-189518238 CCTTAGGACCCACTAACATTAGA No data
Right 967441947 3:189518249-189518271 GCTGCTACGGGACTTAAAAATGG No data
967441939_967441949 20 Left 967441939 3:189518216-189518238 CCTTAGGACCCACTAACATTAGA No data
Right 967441949 3:189518259-189518281 GACTTAAAAATGGGCACATCTGG No data
967441939_967441944 -3 Left 967441939 3:189518216-189518238 CCTTAGGACCCACTAACATTAGA No data
Right 967441944 3:189518236-189518258 AGAACCAGGGTGAGCTGCTACGG No data
967441939_967441945 -2 Left 967441939 3:189518216-189518238 CCTTAGGACCCACTAACATTAGA No data
Right 967441945 3:189518237-189518259 GAACCAGGGTGAGCTGCTACGGG No data
967441939_967441950 24 Left 967441939 3:189518216-189518238 CCTTAGGACCCACTAACATTAGA No data
Right 967441950 3:189518263-189518285 TAAAAATGGGCACATCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967441939 Original CRISPR TCTAATGTTAGTGGGTCCTA AGG (reversed) Intergenic
No off target data available for this crispr