ID: 967441942

View in Genome Browser
Species Human (GRCh38)
Location 3:189518224-189518246
Sequence ACCCTGGTTCTAATGTTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967441942_967441949 12 Left 967441942 3:189518224-189518246 CCCACTAACATTAGAACCAGGGT No data
Right 967441949 3:189518259-189518281 GACTTAAAAATGGGCACATCTGG No data
967441942_967441945 -10 Left 967441942 3:189518224-189518246 CCCACTAACATTAGAACCAGGGT No data
Right 967441945 3:189518237-189518259 GAACCAGGGTGAGCTGCTACGGG No data
967441942_967441951 17 Left 967441942 3:189518224-189518246 CCCACTAACATTAGAACCAGGGT No data
Right 967441951 3:189518264-189518286 AAAAATGGGCACATCTGGCTGGG No data
967441942_967441948 3 Left 967441942 3:189518224-189518246 CCCACTAACATTAGAACCAGGGT No data
Right 967441948 3:189518250-189518272 CTGCTACGGGACTTAAAAATGGG No data
967441942_967441947 2 Left 967441942 3:189518224-189518246 CCCACTAACATTAGAACCAGGGT No data
Right 967441947 3:189518249-189518271 GCTGCTACGGGACTTAAAAATGG No data
967441942_967441950 16 Left 967441942 3:189518224-189518246 CCCACTAACATTAGAACCAGGGT No data
Right 967441950 3:189518263-189518285 TAAAAATGGGCACATCTGGCTGG No data
967441942_967441952 21 Left 967441942 3:189518224-189518246 CCCACTAACATTAGAACCAGGGT No data
Right 967441952 3:189518268-189518290 ATGGGCACATCTGGCTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967441942 Original CRISPR ACCCTGGTTCTAATGTTAGT GGG (reversed) Intergenic
No off target data available for this crispr