ID: 967441945

View in Genome Browser
Species Human (GRCh38)
Location 3:189518237-189518259
Sequence GAACCAGGGTGAGCTGCTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967441939_967441945 -2 Left 967441939 3:189518216-189518238 CCTTAGGACCCACTAACATTAGA No data
Right 967441945 3:189518237-189518259 GAACCAGGGTGAGCTGCTACGGG No data
967441936_967441945 11 Left 967441936 3:189518203-189518225 CCCAAGAATCAACCCTTAGGACC No data
Right 967441945 3:189518237-189518259 GAACCAGGGTGAGCTGCTACGGG No data
967441942_967441945 -10 Left 967441942 3:189518224-189518246 CCCACTAACATTAGAACCAGGGT No data
Right 967441945 3:189518237-189518259 GAACCAGGGTGAGCTGCTACGGG No data
967441937_967441945 10 Left 967441937 3:189518204-189518226 CCAAGAATCAACCCTTAGGACCC No data
Right 967441945 3:189518237-189518259 GAACCAGGGTGAGCTGCTACGGG No data
967441934_967441945 22 Left 967441934 3:189518192-189518214 CCACTAGGAGGCCCAAGAATCAA No data
Right 967441945 3:189518237-189518259 GAACCAGGGTGAGCTGCTACGGG No data
967441938_967441945 -1 Left 967441938 3:189518215-189518237 CCCTTAGGACCCACTAACATTAG No data
Right 967441945 3:189518237-189518259 GAACCAGGGTGAGCTGCTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967441945 Original CRISPR GAACCAGGGTGAGCTGCTAC GGG Intergenic
No off target data available for this crispr