ID: 967446617

View in Genome Browser
Species Human (GRCh38)
Location 3:189574358-189574380
Sequence GATGGATGGTACCTTTATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967446614_967446617 2 Left 967446614 3:189574333-189574355 CCTGCAGTCTCATAGACATGGCT No data
Right 967446617 3:189574358-189574380 GATGGATGGTACCTTTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967446617 Original CRISPR GATGGATGGTACCTTTATTC TGG Intergenic
No off target data available for this crispr