ID: 967448929

View in Genome Browser
Species Human (GRCh38)
Location 3:189600151-189600173
Sequence AGTTTTGTCAAACTCTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967448929_967448936 27 Left 967448929 3:189600151-189600173 CCCCAGAAGAGTTTGACAAAACT No data
Right 967448936 3:189600201-189600223 TACTCATCACTGTTGGGAGAGGG No data
967448929_967448935 26 Left 967448929 3:189600151-189600173 CCCCAGAAGAGTTTGACAAAACT No data
Right 967448935 3:189600200-189600222 CTACTCATCACTGTTGGGAGAGG No data
967448929_967448933 21 Left 967448929 3:189600151-189600173 CCCCAGAAGAGTTTGACAAAACT No data
Right 967448933 3:189600195-189600217 ATAACCTACTCATCACTGTTGGG No data
967448929_967448937 28 Left 967448929 3:189600151-189600173 CCCCAGAAGAGTTTGACAAAACT No data
Right 967448937 3:189600202-189600224 ACTCATCACTGTTGGGAGAGGGG No data
967448929_967448932 20 Left 967448929 3:189600151-189600173 CCCCAGAAGAGTTTGACAAAACT No data
Right 967448932 3:189600194-189600216 AATAACCTACTCATCACTGTTGG No data
967448929_967448938 29 Left 967448929 3:189600151-189600173 CCCCAGAAGAGTTTGACAAAACT No data
Right 967448938 3:189600203-189600225 CTCATCACTGTTGGGAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967448929 Original CRISPR AGTTTTGTCAAACTCTTCTG GGG (reversed) Intergenic
No off target data available for this crispr