ID: 967448931

View in Genome Browser
Species Human (GRCh38)
Location 3:189600153-189600175
Sequence CAAGTTTTGTCAAACTCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967448931_967448936 25 Left 967448931 3:189600153-189600175 CCAGAAGAGTTTGACAAAACTTG No data
Right 967448936 3:189600201-189600223 TACTCATCACTGTTGGGAGAGGG No data
967448931_967448938 27 Left 967448931 3:189600153-189600175 CCAGAAGAGTTTGACAAAACTTG No data
Right 967448938 3:189600203-189600225 CTCATCACTGTTGGGAGAGGGGG No data
967448931_967448933 19 Left 967448931 3:189600153-189600175 CCAGAAGAGTTTGACAAAACTTG No data
Right 967448933 3:189600195-189600217 ATAACCTACTCATCACTGTTGGG No data
967448931_967448935 24 Left 967448931 3:189600153-189600175 CCAGAAGAGTTTGACAAAACTTG No data
Right 967448935 3:189600200-189600222 CTACTCATCACTGTTGGGAGAGG No data
967448931_967448932 18 Left 967448931 3:189600153-189600175 CCAGAAGAGTTTGACAAAACTTG No data
Right 967448932 3:189600194-189600216 AATAACCTACTCATCACTGTTGG No data
967448931_967448937 26 Left 967448931 3:189600153-189600175 CCAGAAGAGTTTGACAAAACTTG No data
Right 967448937 3:189600202-189600224 ACTCATCACTGTTGGGAGAGGGG No data
967448931_967448939 30 Left 967448931 3:189600153-189600175 CCAGAAGAGTTTGACAAAACTTG No data
Right 967448939 3:189600206-189600228 ATCACTGTTGGGAGAGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967448931 Original CRISPR CAAGTTTTGTCAAACTCTTC TGG (reversed) Intergenic
No off target data available for this crispr