ID: 967448938

View in Genome Browser
Species Human (GRCh38)
Location 3:189600203-189600225
Sequence CTCATCACTGTTGGGAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967448931_967448938 27 Left 967448931 3:189600153-189600175 CCAGAAGAGTTTGACAAAACTTG No data
Right 967448938 3:189600203-189600225 CTCATCACTGTTGGGAGAGGGGG No data
967448930_967448938 28 Left 967448930 3:189600152-189600174 CCCAGAAGAGTTTGACAAAACTT No data
Right 967448938 3:189600203-189600225 CTCATCACTGTTGGGAGAGGGGG No data
967448928_967448938 30 Left 967448928 3:189600150-189600172 CCCCCAGAAGAGTTTGACAAAAC No data
Right 967448938 3:189600203-189600225 CTCATCACTGTTGGGAGAGGGGG No data
967448929_967448938 29 Left 967448929 3:189600151-189600173 CCCCAGAAGAGTTTGACAAAACT No data
Right 967448938 3:189600203-189600225 CTCATCACTGTTGGGAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967448938 Original CRISPR CTCATCACTGTTGGGAGAGG GGG Intergenic
No off target data available for this crispr