ID: 967451971

View in Genome Browser
Species Human (GRCh38)
Location 3:189635353-189635375
Sequence TGTAAGTTAAAATCACCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967451968_967451971 28 Left 967451968 3:189635302-189635324 CCCAAAAGGAAGAGTGATGACAA 0: 1
1: 0
2: 1
3: 32
4: 309
Right 967451971 3:189635353-189635375 TGTAAGTTAAAATCACCTAAAGG 0: 1
1: 0
2: 0
3: 13
4: 243
967451969_967451971 27 Left 967451969 3:189635303-189635325 CCAAAAGGAAGAGTGATGACAAT 0: 1
1: 0
2: 0
3: 23
4: 288
Right 967451971 3:189635353-189635375 TGTAAGTTAAAATCACCTAAAGG 0: 1
1: 0
2: 0
3: 13
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967451971 Original CRISPR TGTAAGTTAAAATCACCTAA AGG Intronic
902889894 1:19435059-19435081 TGTAAGTTAACATTCCCTAAAGG + Intronic
904190474 1:28739073-28739095 TCTAATGTAAAATCACCTGAAGG + Intronic
905247326 1:36624216-36624238 TGTAAGTTCAGATGAGCTAATGG + Intergenic
905426723 1:37891439-37891461 TCAAAGTTAGAACCACCTAAAGG + Exonic
909027310 1:70497268-70497290 TGTAAGTAATTATAACCTAAGGG + Intergenic
909151492 1:72011472-72011494 TTTAAGGTTAAACCACCTAATGG + Intronic
909635697 1:77814613-77814635 TGTTCATTAAAATCACATAAAGG + Intronic
910843412 1:91583262-91583284 TCTGAGTTACAATCACCAAATGG + Intergenic
910914999 1:92279153-92279175 TGTACATTAAAATCACCTTGCGG + Intronic
910985408 1:93000215-93000237 TCTAAGTTATAATCATTTAAGGG - Intergenic
911493574 1:98600667-98600689 TGGAAATTGAAATCTCCTAATGG + Intergenic
912744714 1:112236348-112236370 GGTAACTTAAAACCACCAAATGG - Intergenic
912836633 1:113002138-113002160 TGTAAGTAAAAATTAATTAATGG + Intergenic
913189936 1:116404945-116404967 TGTAAATCAAAATCACCTGAGGG - Intronic
917040606 1:170802168-170802190 TTTAATTTAAAAACAACTAAGGG + Intergenic
917389402 1:174518054-174518076 CGTACATTAAAATCGCCTAAGGG + Intronic
918763598 1:188448480-188448502 TGTAAGTTTTAAGCAGCTAAAGG - Intergenic
919677124 1:200394609-200394631 TCTAAGTTAAAATTCACTAATGG - Intergenic
921064784 1:211614965-211614987 TGGAAGTTAAAAGAACCTAAAGG + Intergenic
922121341 1:222672449-222672471 TGTATGTCAGAATCACCTAGAGG + Intronic
922396534 1:225207550-225207572 TGTAAGTTGTAATCACACAAAGG + Intronic
924499185 1:244620517-244620539 TGTAAGTTACAATAATCTCATGG + Intronic
1063915198 10:10874661-10874683 TGTTGGTTAAATTTACCTAATGG + Intergenic
1065110542 10:22436498-22436520 TGCAGGTTAAAATTACCTACCGG - Intronic
1068288754 10:54973722-54973744 TGACAGTTAAAATTATCTAAGGG + Intronic
1068327773 10:55516883-55516905 TGTAATTTTATATCAGCTAATGG + Intronic
1071093663 10:81948909-81948931 TGCAGGTTAAAATCAGCCAAGGG + Intronic
1072583139 10:96757624-96757646 TGGAAGTAAAAATGACATAAAGG + Intergenic
1075868742 10:125751804-125751826 TGTACATTAAAATCAGCCAAGGG + Intronic
1076651657 10:131993576-131993598 TGCAAGTTAAAATCACGAGACGG - Intergenic
1077599861 11:3566786-3566808 TGAAAGTTGAAGACACCTAATGG - Intergenic
1079226134 11:18606768-18606790 TGTAACTTAAAAGCAGCTATTGG - Exonic
1079919996 11:26421159-26421181 TGGAAATTAATATCACCTACAGG + Intronic
1080806783 11:35661500-35661522 TCTAACTCAAAATCATCTAAGGG + Intergenic
1080928748 11:36785264-36785286 TTCATGTTAGAATCACCTAAGGG + Intergenic
1083519797 11:63298193-63298215 TGTTTGTTAAAATTATCTAATGG - Intronic
1086990040 11:93292800-93292822 TGTATATTAAAATCACATAAGGG + Intergenic
1087544786 11:99571092-99571114 TATAAGTTAATAACACGTAAAGG + Intronic
1088051882 11:105526477-105526499 TGTAAGTGTAAATGACCTGAAGG - Intergenic
1088215386 11:107502212-107502234 TACAAATTAAAATCAGCTAATGG - Intergenic
1090432902 11:126661694-126661716 TGCATGTTAGAATCACCTGAGGG + Intronic
1098418035 12:70258994-70259016 TGTAAGTAAAAATGTCCTTATGG - Intronic
1099447588 12:82770544-82770566 TGAAAGATAAAATTACCTGAGGG - Intronic
1100310697 12:93392180-93392202 CTTAAGTTAAAATCAACTCAAGG - Intronic
1101061525 12:100977526-100977548 TGTAAATAAAAAAAACCTAAGGG + Intronic
1101162148 12:101988963-101988985 TATAATTTAAAATCAGGTAATGG + Intronic
1101208990 12:102517449-102517471 TGCATATTAGAATCACCTAAGGG - Intergenic
1101956844 12:109219376-109219398 TGTACATTAGAATCACCTAGGGG + Intronic
1103051119 12:117780758-117780780 TGTAATTTAAAATTTCCTAGTGG - Intronic
1104132562 12:125908649-125908671 TGTACGTAAAAATTACCTCAAGG + Intergenic
1105779333 13:23693118-23693140 TGTATGTTGAAATAACCAAAAGG - Intergenic
1106174710 13:27320393-27320415 TGGGAGTTGAAATCATCTAAAGG + Intergenic
1106263161 13:28086316-28086338 AGTAATGTAACATCACCTAAAGG - Intronic
1106710761 13:32329629-32329651 AGGAAGTTAAAATCACATATAGG - Intronic
1108407504 13:50120323-50120345 TATAAGTTAATATCAGCTTAGGG + Intronic
1109945899 13:69431807-69431829 GGGAAGTTTAAATCAACTAATGG - Intergenic
1110092015 13:71463803-71463825 TGGAAGTTAAAAAGACATAAGGG - Intronic
1110905083 13:80876982-80877004 TTTAACTTAAAATCATTTAAGGG - Intergenic
1113022357 13:105901791-105901813 TTTAAATTTTAATCACCTAAGGG + Intergenic
1113730955 13:112641174-112641196 TGTAATTTAAAATTACTTCATGG + Intergenic
1114769829 14:25416270-25416292 TGATAATTAAAATCACCTTATGG - Intergenic
1115271235 14:31555856-31555878 TATAATTTAAAATTACATAAAGG - Intronic
1115560175 14:34575644-34575666 TATAATTTAAAATCATATAAAGG + Intronic
1116503272 14:45647018-45647040 TGTAAGGTAGTATAACCTAAAGG - Intergenic
1116577326 14:46591127-46591149 TGTAATTTAAAATTACTTACAGG + Intergenic
1119882495 14:78111945-78111967 TGTAAATTAAAATGACTAAAAGG - Intergenic
1120365038 14:83556972-83556994 TGTAATTTTAAACCACCAAACGG - Intergenic
1120459044 14:84770106-84770128 TATGACTTAAATTCACCTAAAGG - Intergenic
1122436004 14:101699676-101699698 TATAATTTAAAATCAGGTAATGG - Intergenic
1123915228 15:25017823-25017845 TATAAGTTAGAATCACATATAGG - Intergenic
1127492399 15:59477386-59477408 TGTAATATAAAATCACCTGCAGG - Intronic
1128130787 15:65225789-65225811 TGTGAGTGAAAATCACCTGGAGG - Intergenic
1128186648 15:65648276-65648298 TGCACATTAAAATCACCTGAAGG - Intronic
1128303327 15:66581077-66581099 TGTAAATTAACATCACCTGGGGG + Intergenic
1131699766 15:94921796-94921818 TACAAGTTAAAATCAGCAAAGGG + Intergenic
1132205053 15:99980707-99980729 TGTATGTGAAAATCACACAAGGG + Intronic
1134544497 16:15097321-15097343 TGTAAGTTATAAGAACATAATGG + Intronic
1135056521 16:19236631-19236653 TGCAAATTAAAATCAGCCAAGGG + Intronic
1135362119 16:21824034-21824056 TGTAAGTTATAAGAACATAATGG + Intergenic
1135785663 16:25346920-25346942 TGTAAGGTAAATTTACCTAATGG - Intergenic
1136260522 16:29072121-29072143 TGTAAGTTATAAGAACATAATGG - Intergenic
1137230281 16:46558604-46558626 TGTAATTCAAAATCAGCTAGGGG + Intergenic
1137646438 16:50079172-50079194 TGTCATTAAAAATCTCCTAAAGG + Intronic
1139293920 16:65883332-65883354 TGTAAGTTAAAAAAACTTAGTGG + Intergenic
1140207051 16:72941828-72941850 TGAAAGTTAAAATTTTCTAATGG - Intronic
1203105594 16_KI270728v1_random:1353662-1353684 TATAATGCAAAATCACCTAAAGG - Intergenic
1203127920 16_KI270728v1_random:1608706-1608728 TATAATGCAAAATCACCTAAAGG + Intergenic
1144168019 17:12631697-12631719 TTTAATTTAAAATCAGGTAAAGG - Intergenic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1148401410 17:47364976-47364998 TGTAAGTAGGAATTACCTAAGGG - Intronic
1148481272 17:47961058-47961080 AGCAAGTTAAATTCACCTAAGGG + Intergenic
1149346628 17:55743753-55743775 TGTAATTCAAAAACACCAAAAGG + Intergenic
1153134399 18:1897528-1897550 TTTAGGTTACAATGACCTAAAGG - Intergenic
1153828142 18:8896207-8896229 TGGTAGTTAAAAGCTCCTAAAGG - Intergenic
1155591608 18:27433923-27433945 TGTAAGTTAAAGTCACCAGATGG - Intergenic
1156139452 18:34088673-34088695 TTTAAGTTAAAATCATTTAAAGG - Intronic
1156589041 18:38465373-38465395 TGTGACTTCAAATTACCTAAAGG + Intergenic
1156809465 18:41229163-41229185 TGTATATTAAAATCACCTGTAGG - Intergenic
1157393542 18:47323164-47323186 AGGAAATTAAAATCACCTGATGG + Intergenic
1157933532 18:51849307-51849329 TGGCATTTAAAATCACCTGATGG - Intergenic
1158641736 18:59209375-59209397 TTAAAGTTAAAATTACCAAAGGG + Intergenic
1158680350 18:59561131-59561153 TGTAAATGATAATCACCAAAAGG + Intronic
1160475365 18:79180393-79180415 GGTAAGTTAAAAACACCCATTGG - Intronic
1163343259 19:16723611-16723633 TATAAATTAAAATCAGCCAAGGG - Intronic
1164233006 19:23307622-23307644 TGTATGTTACAATCACCCAGTGG - Intronic
1168461784 19:56565763-56565785 TGTGAGTTAAAAACTCCTAGGGG - Intergenic
1168648508 19:58077367-58077389 TGTGAGTGAAAACCACCTGAAGG + Intronic
927587671 2:24322989-24323011 TGTAAATTAAAATCACAAAAAGG + Intronic
929719954 2:44357771-44357793 TGCAAAATAAAATAACCTAAAGG + Intronic
930437677 2:51365903-51365925 TGTAAATAAAATTTACCTAAAGG + Intergenic
933058977 2:77711465-77711487 CTTCATTTAAAATCACCTAACGG + Intergenic
933888154 2:86739620-86739642 TGTAAAGCAAAATCACCAAAGGG + Intronic
933922024 2:87057086-87057108 TGTAAAGCAAAATCACCAAAGGG - Intergenic
934097546 2:88620545-88620567 AGTATTTTAAAATAACCTAATGG - Intronic
936698886 2:114986149-114986171 TGGAAGTTAAAATAATCAAATGG + Intronic
940047046 2:149420930-149420952 TGCAAGTTAGAATCACCTGGAGG + Intronic
940625141 2:156165975-156165997 TGTAAGTTAAAGCCACCTCTAGG + Intergenic
941204585 2:162555426-162555448 TGAAAATTGAAATGACCTAAAGG - Intronic
941838541 2:170053493-170053515 TAAAAGTTAAAATCAGCAAAGGG - Intronic
942314626 2:174686105-174686127 TGAAATTTGACATCACCTAAGGG - Intergenic
942720806 2:178950451-178950473 TGTGCATTAGAATCACCTAATGG - Intronic
942835058 2:180285123-180285145 TGTATATTAGAATCACCTAGAGG + Intergenic
943686449 2:190823537-190823559 GGGATGTTAGAATCACCTAAGGG - Intergenic
944564469 2:200973692-200973714 CGTAAGATAAAATCAACTCAGGG + Intergenic
945156284 2:206842544-206842566 AGTATGTTAAATTCACCCAATGG - Intergenic
946131075 2:217607377-217607399 TCTATGTTAATATTACCTAAGGG - Intronic
946869598 2:224073892-224073914 TGTATGGTAAACTCACCTGATGG - Intergenic
947140996 2:227019218-227019240 TGCAGGTTAAAATCACCTGGAGG - Intronic
947415108 2:229886978-229887000 AGTAAGTTAAAATAACCCTAAGG + Intronic
948529868 2:238597596-238597618 TTTAAGAGAAAATCACCTATTGG + Intergenic
1169051581 20:2583021-2583043 TGTATGTGAAAATCACCTGGGGG + Intronic
1169583031 20:7047078-7047100 TGTAATTTAAAGTGGCCTAAGGG + Intergenic
1173154090 20:40593327-40593349 TGTTGGTTAAAATGTCCTAATGG + Intergenic
1174664640 20:52246596-52246618 TGTGATGAAAAATCACCTAATGG - Intergenic
1174755113 20:53150592-53150614 TCTAAGGTAAAATCAACTACAGG + Intronic
1176983286 21:15407610-15407632 TATTAGATAAAATCACCTGAGGG - Intergenic
1177588757 21:23134483-23134505 TGTAAGATAAATACACATAAAGG - Intergenic
1181893835 22:26088736-26088758 TGTAAGTTAAAACCATCCAGAGG - Intergenic
949586765 3:5448188-5448210 TGAAATTTAAAATTTCCTAAAGG - Intergenic
951728724 3:25787108-25787130 TGTTAATCAAAATCACCTGAAGG - Intronic
953100199 3:39817493-39817515 TGTAATTTAAAATCTTCTCATGG + Intronic
953138627 3:40206174-40206196 TGAAAATTAAAATCAGCTCATGG + Intronic
954901139 3:54021128-54021150 TGTAAGTTCACATCACAAAAGGG + Intergenic
956423876 3:69112840-69112862 TGTGGATCAAAATCACCTAAAGG - Intronic
957010580 3:75001080-75001102 TGTAATTCAAAATTACATAATGG + Intergenic
957582680 3:82094795-82094817 TCTTATTTAAAATCACCTTATGG + Intergenic
957967113 3:87336507-87336529 TGTGAGTTAATATTACCAAAAGG - Intergenic
960217168 3:115055119-115055141 TGTAAGTTAAAATTACTCTATGG - Intronic
961709822 3:128819547-128819569 TGTATGTTGGAATCACCTGAGGG + Intergenic
962485734 3:135840552-135840574 TGTAACATAAGATCACATAATGG - Intergenic
962621384 3:137183274-137183296 TGTAAATTAAAAGTAGCTAAGGG - Intergenic
964256609 3:154781682-154781704 TTTAACTTAAAATCATCTACGGG - Intergenic
964677274 3:159297724-159297746 TGTAAGTTCCAATCAACTTAGGG + Intronic
965398349 3:168187822-168187844 TGTAGTTTAAAGTCACCCAAGGG - Intergenic
965532610 3:169789477-169789499 TATACATTAAAATCACCTATGGG - Intronic
965652043 3:170944333-170944355 TGCAAGTTAAACCCACGTAATGG - Intergenic
965953045 3:174334265-174334287 TATAGATTAAAATCAGCTAAAGG + Intergenic
967451971 3:189635353-189635375 TGTAAGTTAAAATCACCTAAAGG + Intronic
968354153 3:198089098-198089120 TGTAAGATAAAAGTACCTTATGG - Intergenic
969014295 4:4093111-4093133 TGAAAGTTGAAGACACCTAATGG - Intergenic
971449849 4:26789610-26789632 TGTAAATTAATATAACCTCATGG + Intergenic
972184908 4:36516888-36516910 TATAAGGTGACATCACCTAACGG + Intergenic
972949240 4:44298536-44298558 TGTATTTCAAAATCACCTGAGGG + Intronic
973218736 4:47701015-47701037 TGTAAGTTAAAAGGTACTAATGG - Intronic
974248143 4:59349323-59349345 TGTAAATTAAAATTAGCAAAGGG + Intergenic
975049827 4:69848507-69848529 TGTAAGGAAAAATTCCCTAATGG - Intronic
976653066 4:87456591-87456613 TGAAAGATAAAATCTCCTAGGGG - Intronic
977075781 4:92447399-92447421 TGTAAGTGAAAAACAGCTGAAGG + Intronic
978304841 4:107315602-107315624 TCCCAGTTAAAATCACTTAATGG + Intergenic
978698549 4:111614726-111614748 TGTCTGTTGAAATCTCCTAAAGG + Intergenic
980225202 4:129974582-129974604 GGTGATTTAAAATCACCTATTGG - Intergenic
980900201 4:138897652-138897674 TGTTATTTAACTTCACCTAATGG + Intergenic
982156485 4:152527343-152527365 TGTAATTTATAATTACCAAATGG - Intronic
984409614 4:179379609-179379631 TGGAAGATCAAATCACTTAATGG - Intergenic
984503104 4:180581074-180581096 TGTATATTATAATCACCTAGAGG - Intergenic
986691464 5:10317057-10317079 TTAAAATTAAAATCACCAAAGGG - Intergenic
987061696 5:14249513-14249535 TGCAAATTAAACTCACATAAAGG - Intronic
987230578 5:15889703-15889725 TGCATGTTGAAATCACCTGAGGG - Intronic
987584609 5:19838463-19838485 TGTAAGTTGGAAACACTTAATGG - Intronic
988175306 5:27715748-27715770 TGTAAATCAAAATCAACTGAAGG - Intergenic
988406381 5:30828102-30828124 TGCAATATAAAATAACCTAATGG - Intergenic
991497952 5:67245983-67246005 TGTAACTAAAAATCAACAAAAGG - Intergenic
992460586 5:76955981-76956003 TGTAATTAGAAATGACCTAAAGG + Intronic
992657676 5:78926830-78926852 TGTAATTTAAAATCTTCTAGTGG + Intronic
992923262 5:81550592-81550614 GCTCAGTTAAAATCAGCTAAGGG - Intronic
993452660 5:88091683-88091705 TCCAATTTGAAATCACCTAAGGG + Intergenic
994135572 5:96282804-96282826 TGCAACTTAGAATCACCTGAGGG + Intergenic
994286970 5:97980889-97980911 AGTAAGTAAAAATTACTTAATGG - Intergenic
994814588 5:104568866-104568888 TGAAATTAAAAATAACCTAATGG + Intergenic
995300456 5:110574812-110574834 TATAAATTAAAATCAGCCAAAGG - Intronic
996017694 5:118558716-118558738 TGTCAATTAAAATCACCTCCAGG + Intergenic
998805572 5:145915063-145915085 GGTAGGTTAAGATCACTTAAGGG - Intergenic
999661155 5:153864002-153864024 TGTAAGTGAGAATCATATAAAGG + Intergenic
1001156091 5:169273491-169273513 TGCAAATTAGAATCACCTGAGGG + Intronic
1002832884 6:839878-839900 TTTAAATTAAAATTCCCTAATGG - Intergenic
1003771754 6:9312422-9312444 TGCATGTTAAAATCACCAGAAGG - Intergenic
1004230172 6:13825847-13825869 TGTAAGTATAAATTACCAAATGG + Intergenic
1004639577 6:17502175-17502197 TGTCAATTAAAATTACATAAGGG - Intronic
1008661103 6:53668964-53668986 TGTAATTTTAAATGACCTAGGGG + Intergenic
1009335434 6:62483204-62483226 TCTAAATTAAAATAAGCTAACGG + Intergenic
1009589769 6:65652513-65652535 TGTATGTTCAAATCACAGAAAGG + Intronic
1010218009 6:73421988-73422010 TGCAAGTTTAAATCAGCCAAAGG - Intronic
1011814902 6:91177910-91177932 AGTAAATTAAAATCACCTGTTGG + Intergenic
1012212513 6:96539024-96539046 TATAAATTAAAATAACGTAAAGG + Intronic
1013990139 6:116244463-116244485 TGTAAATCAGAATCACCTGACGG - Exonic
1014462979 6:121720659-121720681 TCTAAGGTAAAATCATCTATTGG - Intergenic
1015012871 6:128373425-128373447 TGTATATTAAAATCACCTATGGG + Intronic
1015109852 6:129580316-129580338 TGTAAATTAAAATAAACAAATGG + Intronic
1016499846 6:144707646-144707668 TGTAAATCAGAATCACCTGATGG + Intronic
1016903231 6:149122697-149122719 TGTAAATTAAAACCACCATAAGG + Intergenic
1019846688 7:3509879-3509901 TGCACGTTAGAATCACCTAGTGG + Intronic
1021803682 7:24333765-24333787 TGTCAGTAAAAATCAGATAAGGG + Intergenic
1023805811 7:43872251-43872273 TGCAAATTGAAATCATCTAAGGG - Intronic
1023884528 7:44343457-44343479 TACAGATTAAAATCACCTAATGG - Intergenic
1024109148 7:46127618-46127640 TGTAAGTTAGAATCATAGAAAGG + Intergenic
1026103205 7:67399563-67399585 TGTATGTTCAAATCACGTAGGGG - Intergenic
1026169408 7:67940750-67940772 TGTAAGTATAATTCACCTAATGG - Intergenic
1029919736 7:104250454-104250476 TGTATGTTTTAATCACCTATGGG - Intergenic
1030860140 7:114615396-114615418 ACTAAGCTAAAATCACCTTAAGG - Intronic
1033923143 7:146420175-146420197 TGTAAGTTAAAATCAGCACATGG - Intronic
1034552088 7:151827561-151827583 TGCATGTTAGAATCACCTGAGGG - Intronic
1037057394 8:14459070-14459092 TGCAAGTTATAACCAACTAATGG - Intronic
1038822162 8:30962545-30962567 TGTAAATTAATTTCACATAATGG - Intergenic
1039231771 8:35456272-35456294 TGTGTGTTAAAATCACCTGGAGG + Intronic
1039236434 8:35507447-35507469 TGTAAGTAAGAATCACTTCATGG + Intronic
1039455465 8:37703061-37703083 TGAAAGCCAAAGTCACCTAAAGG + Intergenic
1042143161 8:65699763-65699785 TGTAAGTTATAAACACAGAAGGG - Intronic
1042889859 8:73596889-73596911 TGTAATTCCAAATTACCTAAGGG + Intronic
1044194678 8:89360681-89360703 TGTCAATAAAAATCAACTAAGGG + Intergenic
1044675972 8:94729064-94729086 TGAAAGTTAAAATCAAGAAATGG + Intronic
1044900921 8:96943616-96943638 TTTAAGTTAAAATGAAATAATGG + Intronic
1047939970 8:129820133-129820155 TCTAAATTAAAATCACCGTATGG - Intergenic
1049922115 9:374788-374810 TGTAATTTAAAATCATCTAGTGG - Intronic
1050380795 9:5026910-5026932 TGTAAATTAAAATAGCCCAAAGG + Intronic
1051003924 9:12318770-12318792 TATAACATAAAATCATCTAAAGG + Intergenic
1051770579 9:20574043-20574065 TGAAAATCAAAATCACCTATAGG + Intronic
1053191465 9:36073948-36073970 TGTAACTTAAAATCAGCCATGGG + Intronic
1057428840 9:94976356-94976378 TGTAAGTGAAAATTCCCCAAAGG + Intronic
1057765183 9:97910490-97910512 TGTAAATTAAAGTCTGCTAAAGG + Exonic
1059099762 9:111458871-111458893 TGCAAGTTAAAACCAGCCAAAGG - Intronic
1059102883 9:111486320-111486342 TGGAGGTTAAAATTGCCTAACGG - Intergenic
1059809772 9:117843245-117843267 TGTAAAATAGAATCAGCTAATGG - Intergenic
1060111259 9:120908465-120908487 TGTAACTTAAAAGCAGCTATTGG - Intronic
1061397314 9:130350233-130350255 TCTAAGTAAAATTCACATAATGG + Intronic
1186609553 X:11125673-11125695 TGTTATTTAAAATCATCAAATGG + Intergenic
1188074797 X:25761808-25761830 TGCAAATTACAATCACCTGAGGG - Intergenic
1188151095 X:26676624-26676646 TGTAAATTAAAGTTACCCAAAGG + Intergenic
1189154757 X:38745782-38745804 TGTAAGTTAAAATAAACTCCCGG - Intergenic
1189452664 X:41153090-41153112 TGTAAGCTAAAATAAACTATGGG + Intronic
1189530221 X:41872865-41872887 TGACAGTTCAAATCACCTCATGG + Intronic
1189812207 X:44791132-44791154 TGTATTTTAAGATTACCTAACGG - Intergenic
1193022823 X:76809934-76809956 TGTAGGCTAAAAGGACCTAATGG + Intergenic
1193239607 X:79152095-79152117 TGCAAGTTAATATCAACAAAAGG + Intergenic
1194686655 X:96926201-96926223 TGTAAGTTAAAGTCAGTAAAAGG + Intronic
1197916286 X:131539528-131539550 TGCAAATTGAAATAACCTAAGGG + Intergenic
1200703436 Y:6421555-6421577 TGTACCTAAAAATCACCTAGGGG + Intergenic
1201030674 Y:9743152-9743174 TGTACCTAAAAATCACCTAGGGG - Intergenic