ID: 967454414

View in Genome Browser
Species Human (GRCh38)
Location 3:189666847-189666869
Sequence TTGTGTGTATGTATGTAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1602
Summary {0: 1, 1: 1, 2: 7, 3: 188, 4: 1405}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967454414 Original CRISPR TTGTGTGTATGTATGTAAAT GGG Intronic
900818948 1:4871529-4871551 GTGTGGGTATGTGTGTATATGGG - Intergenic
900823596 1:4908954-4908976 TTCTGTGTTTGTGTTTAAATTGG - Intergenic
900880101 1:5374865-5374887 ATGTGTGTATGTGTGTATGTTGG - Intergenic
901206456 1:7500120-7500142 GTGTGCGTGTGTATGTATATGGG + Intronic
901634058 1:10661974-10661996 TTGTGTGCATGTAATTAACTGGG - Intronic
902053161 1:13579934-13579956 TTGTTTGTTTTTTTGTAAATTGG - Intergenic
902111761 1:14084966-14084988 ATGTGTGTATGTGTGTAAATTGG + Intergenic
902293280 1:15448809-15448831 TTTTGTGTATGTCTTTATATTGG + Intronic
902684854 1:18069497-18069519 TTGTGTGTGTGTGTGGAAACAGG - Intergenic
902696214 1:18142714-18142736 TTGTTTGCATATATGCAAATTGG + Intronic
902912395 1:19609752-19609774 TCGTATGTAAATATGTAAATAGG - Intronic
902983325 1:20140671-20140693 TTGTGTGAGTGTGTGTTAATTGG + Intronic
903157510 1:21457182-21457204 GTGTGTGTATGTATGTGTGTGGG + Intronic
903282747 1:22259310-22259332 GTGTGTGTTTGTCTGTAAAGTGG + Intergenic
903396909 1:23008509-23008531 TTGTGTGTATGTGTGGAGACAGG + Intergenic
903727325 1:25459922-25459944 TTGTGTGTATGTAACTCAAGAGG + Intronic
904435311 1:30491016-30491038 GTGTGTGTGTGTGTTTAAATTGG - Intergenic
904991683 1:34598357-34598379 GTGTGTGTGTGTATGTATTTTGG - Intergenic
905694446 1:39964648-39964670 GTGTGTGTGTGTGTGTGAATGGG + Intronic
906072104 1:43024576-43024598 GTGTGTGTGTGTGTGTCAATGGG + Intergenic
906296268 1:44650875-44650897 GTATGTGCATGTATGTACATGGG - Exonic
906675426 1:47690007-47690029 GTGTGTGTGTGTGTGTGAATAGG - Intergenic
907062216 1:51440303-51440325 GTGTGTGTGTGTATGTGAGTAGG + Intronic
907563967 1:55417322-55417344 TTGTGTGTGTGTAGGTAGGTAGG + Intergenic
907566681 1:55441730-55441752 GTGTGTGTCTGTCTGTAAAGAGG - Intergenic
908077915 1:60541422-60541444 GTGTGTGTGTGTGTGTTAATAGG + Intergenic
908520764 1:64939384-64939406 TTGTGTGAATGTATGGAAGTTGG - Intronic
908787666 1:67751160-67751182 GTATGTGTATCCATGTAAATGGG - Intronic
909258528 1:73456041-73456063 ATGTATGTATGTATGTATACTGG - Intergenic
909315882 1:74217858-74217880 TTATGTGTGTGTATGTAATATGG + Intronic
909575161 1:77167167-77167189 TTGTGTGTGTGCATAGAAATGGG - Intronic
909651476 1:77980359-77980381 GTGTGTGTGTGTGTGTAAATTGG + Intronic
909665961 1:78133782-78133804 GTGTGTGTATGTATGTATTATGG + Intronic
909751987 1:79172756-79172778 TAGGGTGTTTTTATGTAAATAGG - Intergenic
909761766 1:79296993-79297015 TTCTGTGCATGCAAGTAAATTGG + Intergenic
909818395 1:80027032-80027054 GTGTACGTATGTATGTATATAGG - Intergenic
909845682 1:80391083-80391105 GTGTATGTGTGTATGAAAATAGG + Intergenic
909872895 1:80765866-80765888 TTGTGTCTATGTATTTTAATTGG + Intergenic
909924631 1:81425224-81425246 TTGTGTGTATATATGTGATAGGG - Intronic
910040591 1:82846848-82846870 GTGTGTGTGTGTGTGTAAATTGG - Intergenic
910110683 1:83679708-83679730 TTGTTTGTGGGAATGTAAATTGG - Intergenic
910238983 1:85065567-85065589 TTGTGTGTGTGTGTGTAGAGTGG + Intronic
910303217 1:85731938-85731960 TTGTGTGTGTGTATATGTATGGG - Intronic
910373719 1:86546461-86546483 TGGTGTGTGTGTATGTATGTAGG - Intergenic
910703252 1:90100037-90100059 TTGTGTGTATTTTTATATATAGG + Intergenic
910754074 1:90667809-90667831 ATGTGTGTATGAATATATATAGG + Intergenic
911173804 1:94798095-94798117 GTGTGTGTGTGTGTGTAAGTGGG + Intergenic
911688158 1:100800941-100800963 GTGTGTGTGTGTGTGTAACTTGG - Intergenic
912129574 1:106585288-106585310 GTGTGTATATATATGTAAAGGGG + Intergenic
912181583 1:107225409-107225431 TTGTGTGAAAATATGTAAATAGG + Intronic
912325586 1:108757144-108757166 TTGTATGTATATATGAAGATGGG + Intronic
912604623 1:110976544-110976566 TTGTATGTGTATATGTAAAAGGG + Intergenic
913100478 1:115559544-115559566 ATGTGTGTATGTATGTGTGTTGG - Intergenic
913111233 1:115658936-115658958 GTGTGTGTGTGTGTGTACATGGG - Intronic
914701767 1:150140417-150140439 GTGTGTGTGTGTATTTAAAGTGG + Intronic
914825878 1:151137877-151137899 TAGTGTGTATGTATGCAATGGGG - Intronic
915209093 1:154293495-154293517 GTGTGTGTGTGTGTGTAATTTGG - Intergenic
916001256 1:160618408-160618430 GTGTGTGTGTGTGTGTAAAATGG + Intronic
916001616 1:160621872-160621894 GTGTGTGTGTGTGTGTAAAATGG + Intronic
916188417 1:162155420-162155442 ATGTATATATGTATGTATATAGG - Intronic
916322525 1:163521061-163521083 ATGTGTGTGTGTATATATATGGG - Intergenic
916347127 1:163806060-163806082 TTGTGTGTATGTATGGAGTCTGG + Intergenic
916383441 1:164239502-164239524 GTGTGTGTATATATATATATAGG - Intergenic
916477942 1:165187458-165187480 GTGTGTGTGTGTGTGTACATGGG + Intergenic
916709705 1:167392879-167392901 GTGTGTGTATATAAATAAATTGG - Intronic
916984785 1:170179410-170179432 TCGTGTGTATGTATTTTGATGGG + Intergenic
917283530 1:173401760-173401782 GTGTGTATATGTATGTATATGGG - Intergenic
917489976 1:175489784-175489806 ATATGTATATGTATGTATATAGG - Intronic
917682148 1:177378136-177378158 ATGTATGTATGTATGTAAAGGGG - Intergenic
917899215 1:179525476-179525498 ATGTATGTATGTATGTATGTAGG - Intronic
918096330 1:181337959-181337981 TTGTTGGTAGGAATGTAAATTGG - Intergenic
918559849 1:185851812-185851834 TTGTGTGTATGTCTGTGTGTTGG - Intronic
918642192 1:186856049-186856071 GTGTGTTTGTGTGTGTAAATTGG - Intronic
918645448 1:186899137-186899159 GTGTGTATATGTGTGTAAAGGGG + Intronic
918676581 1:187293731-187293753 GTGTGTGTATATATATAAAACGG - Intergenic
918717592 1:187809664-187809686 TTGTATGTATGTATGTAGGTAGG - Intergenic
918717593 1:187809668-187809690 TTATTTGTATGTATGTATGTAGG - Intergenic
918749168 1:188249809-188249831 TTGTGTGTGTGTGTTTCAATAGG - Intergenic
918881926 1:190135466-190135488 TGGTGTGTATGCATACAAATGGG + Intronic
918902342 1:190439533-190439555 GTGTGTGTGTGTATGTGTATGGG + Intronic
919000789 1:191828501-191828523 ATGTGTATATATATATAAATTGG + Intergenic
919090243 1:192970268-192970290 TTGTATGTATATATGTATGTAGG - Intergenic
919154613 1:193747541-193747563 ATGAGTGTTTGTATGTAGATAGG + Intergenic
919272423 1:195365142-195365164 TTGTGTGTGTGTCTGTGAGTGGG - Intergenic
919493308 1:198232990-198233012 TTGTTTTCATGTTTGTAAATGGG - Intronic
919636736 1:200010515-200010537 TTGTGTGTGTGTATGTTACGGGG - Intergenic
920003957 1:202819043-202819065 ATGTGTGTATGTATGTTATCAGG - Intergenic
920520053 1:206617161-206617183 TTTTGAGTTTGTATGTGAATAGG - Intergenic
920852737 1:209639602-209639624 ATGTGTATATGTATGCACATAGG - Intronic
921174981 1:212585802-212585824 GTGTGTGTATGCATGTAATGAGG + Intronic
921467008 1:215500887-215500909 GTGTGTGTCTGTATATATATGGG - Intergenic
921596892 1:217064168-217064190 TTGTATAGATGTATGTATATAGG + Intronic
921913994 1:220585968-220585990 GTGTGTATACGTATGTAAAGTGG - Intronic
922022362 1:221717600-221717622 TTGTGTGTGTGTTTGAATATGGG - Intronic
922287890 1:224184964-224184986 GTGTGTGTGTGTGTGTAAACGGG - Intronic
922746382 1:228046552-228046574 TTGTGTGTGTGCATGTGCATGGG + Intronic
923483825 1:234410248-234410270 CAGTGTGTATGCATGTAAATGGG + Intronic
923771844 1:236944368-236944390 TTGTGTGTGTGTGTGTGAATTGG + Intergenic
924230284 1:241957085-241957107 GTGTGTGTGTGTGTGTAAAAGGG + Intergenic
924298652 1:242614351-242614373 TTTTGTGTGTGTGTGAAAATGGG + Intergenic
924621142 1:245661895-245661917 GTGTGTGTATGTATATCATTGGG - Intronic
924621159 1:245662080-245662102 GTGTGTGTATGTATATCATTGGG - Intronic
924745178 1:246825513-246825535 GTGTGTGTATGTGTGTATATGGG + Intergenic
1062899222 10:1129537-1129559 TCTTGTATATGTATGTATATTGG + Exonic
1063059272 10:2534317-2534339 GTGTGTGTGTGTGTGTAAATTGG + Intergenic
1063072630 10:2681246-2681268 TTATGTAGATGTATGTAACTTGG + Intergenic
1063079790 10:2755208-2755230 ATGTGTGCATGTGTGTATATAGG - Intergenic
1063079791 10:2755238-2755260 ATGTGTGTATGTGTGTATATAGG - Intergenic
1063185713 10:3649433-3649455 GTGTGTGTATGTGTGTAAAATGG - Intergenic
1063225295 10:4009811-4009833 TTGTGTGTGTGTGTGCACATGGG + Intergenic
1063232802 10:4082504-4082526 GTGTGTGTATGTGTGTAACAGGG + Intergenic
1063293828 10:4781078-4781100 GTGTGTGAATGTGTGTAATTTGG - Intergenic
1063506404 10:6604255-6604277 GTGTGTGTGTGTGTGAAAATAGG + Intergenic
1063859688 10:10294091-10294113 GTGTGTGTCTATATGTAAGTAGG + Intergenic
1063933619 10:11054507-11054529 GTGTGTGTGTGTGTGTTAATAGG + Intronic
1064162787 10:12960147-12960169 TTGTGTGTGTGTGTGTGAAATGG - Intronic
1064566739 10:16647292-16647314 TTGTGGATAGGTATGTAAAGTGG + Intronic
1064717256 10:18189408-18189430 TTGGATGCATGTATTTAAATTGG + Intronic
1064769520 10:18709802-18709824 GTGTGTGTATATATATATATAGG - Intergenic
1064930870 10:20625036-20625058 GTGTGTGTATGTGTGAACATGGG - Intergenic
1065148432 10:22797218-22797240 GTGTGCGTATATATGTATATGGG + Intergenic
1065270083 10:24020608-24020630 GTGTGTGTATATATGTGTATTGG - Intronic
1065279909 10:24125348-24125370 GTGTGTGTGTGTGTGTGAATAGG + Intronic
1065678137 10:28199871-28199893 GTGTGTGTGTGTGTTTAAATGGG - Intronic
1066094991 10:32063936-32063958 GTGTGTGTGTGTGTGTAATTAGG + Intergenic
1066439659 10:35426230-35426252 GTGTGTGTGTGTGTGTGAATGGG - Intronic
1066557709 10:36633226-36633248 GTGTGTGTATATATATATATGGG - Intergenic
1066590669 10:36990315-36990337 TTGTGGGTTTGTTTGTGAATGGG - Intergenic
1067194005 10:44098683-44098705 TTCTGTGTCTGTATTTAAAATGG - Intergenic
1067514848 10:46930228-46930250 GTGTGTGTATTTATATAAAGAGG + Intronic
1067647407 10:48121586-48121608 GTGTGTGTATTTATATAAAGAGG - Intergenic
1067726118 10:48772405-48772427 GTGTGCGTGTGTATGTAAGTAGG + Intronic
1067767863 10:49101993-49102015 GTGTGTGTATGAATGTCAATAGG + Intronic
1068381845 10:56264289-56264311 GTGTGTGTGTGTGTGTTAATTGG - Intergenic
1068521975 10:58086889-58086911 TTCTATCTATGTATATAAATTGG - Intergenic
1068765892 10:60763092-60763114 GTGTGTGTGTGTGTGTTAATTGG - Intergenic
1068872162 10:61956908-61956930 GTGTGTGTTTGTGTGTAAATTGG + Intronic
1068903342 10:62295033-62295055 GTGTGTGTATATATATATATAGG + Intergenic
1069728490 10:70596338-70596360 TTGAGTGTGTGTCTGTGAATGGG + Intergenic
1069819446 10:71218320-71218342 TGGTGTGTTTGTGTATAAATAGG + Intronic
1070375194 10:75823747-75823769 GTGTGTGTGTGTATGTAAGTAGG - Intronic
1070392487 10:75983585-75983607 ATGCGTCTATGTATGTGAATAGG + Intronic
1070637178 10:78138733-78138755 GTGTGTGTATTTATGTGTATAGG + Intergenic
1071058185 10:81535455-81535477 GTGTGTGTATGTTTTTTAATTGG + Intergenic
1071111271 10:82160162-82160184 TTGTGTTTAGGTAGGTAAAATGG - Intronic
1071195288 10:83152414-83152436 TTGTGAGTAATTATGTAAAGTGG + Intergenic
1071219863 10:83452784-83452806 GTGTGTGTGTGTGTGTAGATAGG - Intergenic
1071231823 10:83597077-83597099 GTGTGTGTGTGTAAATAAATTGG + Intergenic
1071271548 10:84012053-84012075 GTGTGTGTGTGTATTTAAGTAGG - Intergenic
1071703011 10:87962573-87962595 ATGTATGTATGTATGTATATTGG + Intronic
1071894740 10:90053481-90053503 GTGTGTGTGTGTAGATAAATAGG - Intergenic
1072042883 10:91626270-91626292 GTGTGTGTGTGTGTGTAAGTGGG + Intergenic
1072047181 10:91668759-91668781 TTGTTTGTGGGAATGTAAATTGG - Intergenic
1072875419 10:99168081-99168103 GTGTGTGTGTGTGTGTAAATAGG - Intronic
1073158738 10:101370929-101370951 ATATGTGTGTGTATGTATATAGG - Intronic
1073316969 10:102589095-102589117 GTGTGTGTGTGTATGGAGATGGG + Intronic
1073653635 10:105388427-105388449 TTGTGTGTATATATGTATGAAGG - Intergenic
1073669962 10:105576899-105576921 GTGTGTGTGTGTAAATAAATAGG - Intergenic
1073839864 10:107485925-107485947 GTGTGTGTATGTGTGTATACAGG - Intergenic
1073854675 10:107660836-107660858 GTGTGTGTATGTGTATAAAGGGG - Intergenic
1073938367 10:108662713-108662735 GTGTATGTTTGTATGTATATAGG - Intergenic
1074198295 10:111208372-111208394 GTGTGTGTGTGTGTGTAAAAGGG + Intergenic
1074221295 10:111440819-111440841 TTTTGTTAATGGATGTAAATTGG - Intergenic
1074435417 10:113430185-113430207 TTTTGTGTATGTATGCATATGGG + Intergenic
1074663573 10:115691221-115691243 TTGTTTGTGGGAATGTAAATTGG - Intronic
1074799512 10:116985288-116985310 TTGTGTCTTTGTTTGTAAAATGG - Intronic
1074869080 10:117562926-117562948 AGGTGTGTATGTGTGTATATGGG + Intergenic
1074869145 10:117563470-117563492 GTGTGTGCATGTATGTCTATGGG + Intergenic
1075541290 10:123316698-123316720 GTGTGTGTGTGTATGTAATAGGG + Intergenic
1075913117 10:126142893-126142915 TTGTGTGTGTGCATGTGCATGGG + Intronic
1076240581 10:128902589-128902611 TTTTGTGCATATATGTCAATGGG - Intergenic
1076600475 10:131654066-131654088 TTGTGTGTGTGTGTGTATGTGGG - Intergenic
1076926938 10:133495808-133495830 ATATATGTATATATGTAAATGGG + Intergenic
1076935018 10:133562305-133562327 GTGTGTGTGTGTATTTAAAAGGG + Intronic
1077004842 11:349498-349520 GTGTGTGTGTGTGTGTAAACTGG - Intergenic
1077636542 11:3845628-3845650 TTTTGTGTGTGTATGCAGATGGG - Intergenic
1077687103 11:4303898-4303920 TTGAGTACATGTACGTAAATAGG + Intergenic
1077692264 11:4355087-4355109 TTGAGTACATGTACGTAAATAGG + Intergenic
1077784059 11:5363434-5363456 GTGTGTGTATGTGTGTCAAGAGG - Intronic
1077819797 11:5726132-5726154 TTGTGTGTATGTATGTATTCAGG + Intronic
1077921573 11:6645950-6645972 TTCTGTGTATATATGTGAAAGGG - Intronic
1078034101 11:7784554-7784576 TTGGGTGTATGTATGTGTTTAGG - Intergenic
1078162164 11:8850126-8850148 TTGTGTGTGTGTGTGTGACTGGG - Intronic
1078798438 11:14617707-14617729 GTGTGTGTGTGTGTGTATATGGG + Intronic
1078818524 11:14851520-14851542 GTGTGTGTGTGTGTGTTAATGGG + Intronic
1079190368 11:18272092-18272114 TTGTGTGTAGGTATTTTATTTGG + Intergenic
1079282898 11:19103898-19103920 TTGTGTGTGTGTATCCTAATGGG + Intergenic
1079352897 11:19707986-19708008 ATGTGTGTATGTGTGTTTATAGG - Intronic
1079405194 11:20138786-20138808 GTGTGTGTATGCATGCATATGGG - Intergenic
1079619907 11:22541239-22541261 ATGTGCGTGTGTATGTAAAAAGG + Intergenic
1079634451 11:22718296-22718318 TTGTGTGTATATATGTATCATGG + Intronic
1079920339 11:26426101-26426123 CTGTGTGTGTGTCTGTAAATGGG + Intronic
1079942729 11:26701817-26701839 TTGTGTGTATGTATATACACAGG - Intronic
1081649294 11:44812867-44812889 CTGTGTGTGTGTATGTACACTGG - Intronic
1081790466 11:45779677-45779699 TTTTGTGCATGAATGCAAATAGG - Intergenic
1081827730 11:46073624-46073646 TTTTGTGTATATATGTATGTGGG - Intronic
1082119350 11:48361663-48361685 ATGTATGTATGTATGTATGTAGG + Intergenic
1082700379 11:56422407-56422429 GTGTGTGTATGTTTGTAAGGAGG + Intergenic
1082709503 11:56537145-56537167 GTGTGTGTATATATATATATGGG + Intergenic
1082768685 11:57188569-57188591 TTGTGTGTGTGTGTGTCAAAGGG - Exonic
1082902903 11:58275538-58275560 TTGGGTGTATGTATTAAAATGGG + Intergenic
1083736948 11:64686791-64686813 GTGTGTGCATGTATGTCCATAGG + Intronic
1083774301 11:64886313-64886335 GTGTGTGTATGTGTGTATGTGGG + Intronic
1083889225 11:65587684-65587706 TTGTGTCCTTGTATGTAAAATGG - Intronic
1084219556 11:67668905-67668927 CTGTGTGTCTGTATGTGTATGGG + Intronic
1084908690 11:72369763-72369785 CTGTGTGTGTGTATGTATGTGGG + Intronic
1085113358 11:73908409-73908431 ATGTGTGTATATATATATATGGG + Intronic
1085878967 11:80442990-80443012 GTGTGTGTGTGTGTGTAGATAGG + Intergenic
1085944637 11:81253402-81253424 ATGGTTGTATGTAAGTAAATGGG + Intergenic
1085963554 11:81493711-81493733 GTATCTGTGTGTATGTAAATGGG - Intergenic
1086381267 11:86257207-86257229 GTGTGTGTGTGTATGAAGATAGG + Intronic
1086580063 11:88389451-88389473 GTGTGTGTGTGTTTGTAAGTGGG - Intergenic
1086722015 11:90132771-90132793 TTGTGTGTATGCATATAAGGGGG + Intronic
1086885127 11:92197095-92197117 TTGTGTGTGTATATTTAGATGGG - Intergenic
1086892561 11:92274975-92274997 TACTGTGTATGTGTGCAAATAGG - Intergenic
1086893945 11:92290583-92290605 TTTTGTGTGTGTGTGGAAATGGG - Intergenic
1087323313 11:96689145-96689167 TTCTATGTATGTAGGTAAAGAGG - Intergenic
1087332871 11:96804840-96804862 ATATGTGTATATATGTACATAGG - Intergenic
1087367191 11:97235255-97235277 TTTTGTGTGTGTGTGTGAATGGG - Intergenic
1087440748 11:98180119-98180141 TCTTGTGTGTGTTTGTAAATTGG + Intergenic
1087551465 11:99655710-99655732 GTGTATGTATGTATATAAAATGG - Intronic
1087551479 11:99656028-99656050 ATGTGTGTATGTGTGTATATAGG + Intronic
1087650252 11:100858115-100858137 GTGTGTGTGTTTATGTAATTAGG + Intronic
1087994184 11:104782970-104782992 GTGTGTGTATGTGTGTGTATGGG + Intergenic
1088003169 11:104907225-104907247 CTGTGTGTTTGTATGTGTATGGG - Intergenic
1088036520 11:105323774-105323796 TTGAGTGTATATAATTAAATAGG + Intergenic
1089082274 11:115786789-115786811 ATGTGTGTATCTGTGTGAATGGG + Intergenic
1089298693 11:117484927-117484949 GTGTGTGTGTGTGTGTAAGTGGG + Intronic
1089658942 11:119973261-119973283 GTGTGTGTGTGTGTGTAAAATGG - Intergenic
1090062941 11:123479231-123479253 TTGTGTCTGTGTTTGAAAATTGG + Intergenic
1090102567 11:123815526-123815548 TTGTGTGTGTGTATGTGTATGGG + Intergenic
1090298543 11:125612791-125612813 GTGTGTGTATGTGTGTATGTGGG + Intronic
1090335075 11:125956626-125956648 TTGTGTGTGTGTCTGTAATCTGG + Exonic
1090366406 11:126210510-126210532 GTGTGTGTGTGTATGTATGTTGG - Intronic
1090496650 11:127219374-127219396 GTGTGTGTATATATATATATAGG + Intergenic
1090540291 11:127695112-127695134 ATGTGTGTGTGTTCGTAAATGGG + Intergenic
1091061698 11:132469524-132469546 GTGTGTGTATGTATGTGTGTGGG + Intronic
1091079195 11:132650565-132650587 GTGTGTGTGTGTATGTCAATTGG - Intronic
1091106474 11:132924139-132924161 GTGTGTGTGTGTATGTGAAGAGG + Intronic
1091196946 11:133739226-133739248 GTGTGTGTAGGTGTGTATATGGG + Intergenic
1091316186 11:134615626-134615648 GTGTGTGTGTGTGTGTGAATGGG + Intergenic
1091336765 11:134775669-134775691 GTGTATGTATGTATGTATTTTGG - Intergenic
1091455293 12:602596-602618 TTGTGTGAATGTATATACCTAGG + Intronic
1091475920 12:772431-772453 GTGTGTGTGTGTATGTATAGGGG + Intronic
1091972434 12:4798593-4798615 GTGTGTGTATGTGTGTAGAAGGG - Intronic
1092037318 12:5348061-5348083 TTGTGTGTGTGTGTGTATCTTGG - Intergenic
1092072498 12:5643057-5643079 GTGTGTGTGTGTGTGTAAAATGG - Intronic
1092559559 12:9596768-9596790 TTGTGTGTGTGTTTCTTAATGGG - Intronic
1092697935 12:11194435-11194457 CTGTGTGTATGAATGTAATATGG + Intergenic
1092937632 12:13378826-13378848 GTGTGTGTGTGTGTGAAAATGGG + Intronic
1092948451 12:13477964-13477986 TTGTGTGTATGTGTGTAAACGGG + Intergenic
1093385231 12:18544987-18545009 TTGTGGTTATGTATGGAAAATGG - Intronic
1093535272 12:20216081-20216103 ATGTGTGTCTATATGTAAGTAGG + Intergenic
1093605406 12:21082811-21082833 ATGTATGTGTGTATGTAAGTGGG + Intronic
1093606189 12:21091669-21091691 GTGTGTGTGTGTATATATATAGG - Intronic
1093735465 12:22615204-22615226 GTGTGTGTGTGTGTGTAAACTGG + Intergenic
1093757046 12:22864109-22864131 TTGTGTGTAGGTGTGTGAAGAGG + Intergenic
1093897620 12:24592698-24592720 GTGTGTGTGTGTATGCACATTGG + Intergenic
1093987280 12:25550104-25550126 TTGTGTGTGTGTATGTGTATTGG + Intronic
1094149342 12:27265268-27265290 ATGTGTGTATGTGTGTGTATAGG + Intronic
1094410804 12:30167170-30167192 GTGTGTGTGTGTATGTATGTAGG - Intergenic
1095268494 12:40187942-40187964 AGTTGTTTATGTATGTAAATAGG + Intergenic
1095282954 12:40377907-40377929 TTTCTTGTATGTATGCAAATTGG - Intergenic
1095302032 12:40596214-40596236 TTGTTGGTAGGGATGTAAATTGG + Intergenic
1095370202 12:41458159-41458181 TTGTGTGTGTGTATGTGAGATGG + Intronic
1095669434 12:44841356-44841378 TTGTGAGGAAATATGTAAATAGG - Intronic
1095953556 12:47794547-47794569 TTGTGTGTATGTGTGTGTATGGG + Intronic
1096056381 12:48655905-48655927 ATGTATGTATGTGTGTAAGTAGG - Intronic
1096581938 12:52591353-52591375 TTGTGTGTGTGTGTGTATTTGGG - Intronic
1096675853 12:53225497-53225519 TTGTGTGTCTGTATGTGAAAGGG - Intronic
1096693341 12:53334325-53334347 GTGTGTGTGTGTGTGTAAGTTGG - Intronic
1096759424 12:53827891-53827913 TTTTATGTATGTGTGTAAAATGG + Intergenic
1097255383 12:57669842-57669864 TTTTGTGTATGTGTGGAAACGGG - Intergenic
1097468450 12:59957378-59957400 TTGTGTGTCTGGAAGTAAAATGG + Intergenic
1097487150 12:60218076-60218098 GTGTGTGTATATATGTAAAATGG - Intergenic
1097490785 12:60268445-60268467 GTGTGTATATATATGTATATGGG - Intergenic
1097500805 12:60399083-60399105 TTGCGTGTGTGTGTGTATATGGG - Intergenic
1097506301 12:60476408-60476430 TTGTGTGTATGTATTTTTGTAGG - Intergenic
1097771755 12:63594481-63594503 GTGTGTGTGTGTATGAAACTTGG + Intronic
1097797303 12:63877285-63877307 TTTTGTGTGTGTATGTATTTTGG + Intronic
1098037769 12:66322866-66322888 TTTTGGGAATATATGTAAATAGG - Intronic
1098241957 12:68477163-68477185 GTGTGTGTATGTTTGTATGTGGG - Intergenic
1098343448 12:69475110-69475132 TTCTGTTTAGGTATTTAAATAGG + Intronic
1098627909 12:72695873-72695895 GTGTGTGTATATATATATATGGG - Intergenic
1098901647 12:76117410-76117432 TTGTGTGTGCGTATGTGAAATGG - Intergenic
1099068947 12:78021168-78021190 ATTTGTCTATGTATGTACATGGG - Intronic
1099084996 12:78234988-78235010 GTGTGTGTATGTGTGTGTATCGG - Intergenic
1099201709 12:79685872-79685894 TTGTGTGTATGTATATATCTAGG - Intronic
1099474879 12:83095972-83095994 TTGTGAGCATGTATGTGAATAGG + Intronic
1099517402 12:83614621-83614643 ATATGTGTATGTGTGTAAATTGG + Intergenic
1099636299 12:85217536-85217558 GTGTGTGTGTGTGTGTATATAGG + Intronic
1099750940 12:86771724-86771746 ATGTGTGTGTGTATGAATATTGG + Intronic
1099827432 12:87795153-87795175 TTGTGTGTGTGTGTGGAGATAGG - Intergenic
1100129537 12:91474383-91474405 TTGTGTTGATGGAGGTAAATAGG - Intergenic
1100363695 12:93900118-93900140 GTGTGTGTGTGTGTGTAGATGGG - Intergenic
1100525399 12:95414719-95414741 GGGTGTGTGTGTATGTATATTGG + Intergenic
1100744811 12:97634059-97634081 GTGTGTGTGTGTGTGTATATTGG - Intergenic
1100985444 12:100198750-100198772 GTGTGTGTGTGTGTGTAGATGGG - Intergenic
1100989129 12:100233250-100233272 TTATATATATGTATGTATATAGG - Intronic
1101163343 12:102002569-102002591 TTGTGTGTATGTGTGTAGTGAGG - Intronic
1101661398 12:106768631-106768653 ATGTGTATGTGTGTGTAAATAGG - Intronic
1102064350 12:109961146-109961168 GTGTGTGTATATATGTATAAAGG + Intronic
1102230570 12:111259073-111259095 TTGTGTGTGTGTGTGGAGATAGG + Intronic
1102547181 12:113665607-113665629 TGGTGTGTGTGTGTGTGAATAGG - Intergenic
1103026278 12:117576824-117576846 TTGTGTGTGTGTGTGTGGATGGG + Intronic
1103052572 12:117793181-117793203 TGGTGTGTATGTGTGCACATTGG - Intronic
1103087795 12:118075218-118075240 GTGTGTGTATATATATATATAGG + Intronic
1103296822 12:119894745-119894767 ATGTGTGTGTGTGTGTATATAGG - Intergenic
1103815723 12:123654165-123654187 TTGGGTGTGTGTATGTATTTGGG + Intronic
1104035577 12:125095019-125095041 GTGTGTCTGTGTGTGTAAATAGG + Intronic
1104040401 12:125126447-125126469 GTGTGTGAGTGTGTGTAAATGGG + Intronic
1104124096 12:125828794-125828816 GTGTGTGTATGTGTGTGCATGGG + Intergenic
1104746543 12:131214492-131214514 TTGTCTGTATTTGTGTAACTTGG - Intergenic
1105632236 13:22181848-22181870 ATTTATGTATGTATGTAAATGGG + Intergenic
1106703368 13:32253924-32253946 ATGTGTGTGTGTGTGTAAACTGG - Intronic
1106782690 13:33075404-33075426 GTGTGTGTGTGTAGGTAAGTCGG - Intergenic
1107003530 13:35580507-35580529 TTGTCAGTATGTAGGTAAGTAGG + Intronic
1107013267 13:35688649-35688671 TTGTGTGGGTGAATGTCAATGGG - Intergenic
1107022097 13:35762655-35762677 GTGTGTGTATGTATGAATGTAGG - Intergenic
1107022162 13:35763436-35763458 ATGTGTGTAGGTGTGTATATAGG - Intergenic
1107099444 13:36573990-36574012 TTGTGTGTATGTGTGAGTATGGG - Intergenic
1107168051 13:37306514-37306536 GTGTGTGTATATATATATATAGG - Intergenic
1107635621 13:42389546-42389568 GTGTGTGTGTGTGTGTAGATAGG + Intergenic
1107781118 13:43903331-43903353 TTTTCTGTATGTTTGTAACTTGG + Intergenic
1108057500 13:46499123-46499145 GTGTGTGTGTGTATGTATAGGGG - Intergenic
1108105927 13:47009171-47009193 ATTTGTGTATGTATATAAAAGGG - Intergenic
1108163049 13:47662796-47662818 ATGTGTGTATGTATGTATGTAGG - Intergenic
1108187768 13:47905551-47905573 GTGTGTGTGTGTATGTATGTAGG - Intergenic
1108404976 13:50091828-50091850 GTGTGTGTGTGTATGTTTATGGG + Intronic
1108653608 13:52507175-52507197 ATGTGTGTATATATATATATAGG + Intergenic
1108870709 13:54981653-54981675 TTGTGTTTATGTATGAAAAATGG + Intergenic
1109020538 13:57085327-57085349 TTGTGTGTATGAAAGGAAAGAGG + Intergenic
1109040171 13:57324108-57324130 GTGTGTGTGTGTATATACATAGG + Intergenic
1109071470 13:57774201-57774223 TTGTGTAGATTTATGTATATGGG + Intergenic
1109141719 13:58720303-58720325 GTGTGTGTGTGTATTTTAATAGG + Intergenic
1109232256 13:59772262-59772284 TTGTGTGTATGTAGATTTATTGG - Intronic
1109289495 13:60456718-60456740 TTGTGTGTATGTGTGTCACCTGG + Intronic
1109447729 13:62465905-62465927 GTGTGTGTATATATATATATTGG + Intergenic
1109488923 13:63068951-63068973 GTGTGTGTATGTATATAATAGGG - Intergenic
1109504233 13:63278627-63278649 TTGTGTGTGTGTATATATGTAGG - Intergenic
1109507839 13:63330096-63330118 TTGTGTGTATGTTTTTAAGATGG - Intergenic
1109881977 13:68490480-68490502 TTGTTTGTGGGAATGTAAATTGG + Intergenic
1109966125 13:69698782-69698804 GTGTGTGTGTGTATGTATAATGG + Intergenic
1109997216 13:70144524-70144546 TTTTCAGTATGTATGCAAATGGG + Intergenic
1110000273 13:70189019-70189041 GTGTGTGTGTGTGTGTATATAGG - Intergenic
1110012549 13:70355941-70355963 TGGGGTGTATGTATGTGAATTGG - Intergenic
1110012865 13:70360638-70360660 GTGTGTGCATGTATGTATAATGG + Intergenic
1110525822 13:76535693-76535715 CTGTTTGTGTGAATGTAAATTGG + Intergenic
1110921538 13:81093525-81093547 GTGTGTGTGTGTATGTATGTTGG + Intergenic
1110922635 13:81108017-81108039 TTCTTTGTGTGTATGTCAATTGG + Intergenic
1111031042 13:82598752-82598774 GTGTGTGTATGTGTGTATAATGG - Intergenic
1111224201 13:85248126-85248148 TGGTGTGTATGTATGTTCTTTGG - Intergenic
1111546687 13:89747292-89747314 GTGTGTATATGTGTGTAAATTGG + Intergenic
1111604735 13:90522365-90522387 TTGTGTGTATATATATATTTCGG - Intergenic
1111721729 13:91955202-91955224 GTGTGTTTATGTATTTAAATTGG + Intronic
1111780890 13:92722308-92722330 TAGTGTCTATATAAGTAAATGGG - Intronic
1112103697 13:96217758-96217780 GTGTGACTATGTATGTATATAGG + Intronic
1112265093 13:97916314-97916336 TTATGTGTATGGAGGGAAATGGG + Intergenic
1112619018 13:101035653-101035675 GTGTGTGTGTGTGTGTAAATTGG + Intergenic
1112861870 13:103839151-103839173 GTGTGTGTGTGTGTGTTAATGGG - Intergenic
1112979616 13:105366839-105366861 TTGTGTGTATATATATAAAATGG - Intergenic
1113007759 13:105726544-105726566 CTCTGTGGATGTCTGTAAATTGG + Intergenic
1113235939 13:108274413-108274435 TTATGTGTATATATTCAAATAGG + Intronic
1113327167 13:109293447-109293469 GTGTGTGTAGGTATGTTCATGGG - Intergenic
1113327195 13:109293658-109293680 GTGTGTGTAGGTATGTGTATAGG - Intergenic
1113342207 13:109437522-109437544 ATGTGTGTATGTATGTATATAGG - Intergenic
1114119819 14:19658856-19658878 GTGTGTGTCTGTGTGTAAGTGGG - Intergenic
1114137793 14:19872314-19872336 ATGTGTATATATATATAAATAGG - Intergenic
1114137794 14:19872344-19872366 ATGTGTATATATATATAAATAGG - Intergenic
1114137795 14:19872374-19872396 ATGTGTATATATATATAAATAGG - Intergenic
1114137796 14:19872404-19872426 ATGTGTATATATATATAAATAGG - Intergenic
1114137797 14:19872434-19872456 ATGTGTATATATATATAAATAGG - Intergenic
1114137799 14:19872496-19872518 ATGTGTATATATATATAAATAGG - Intergenic
1114137801 14:19872558-19872580 ATGTGTATATATATATAAATAGG - Intergenic
1114137802 14:19872588-19872610 ATGTGTATATATATATAAATAGG - Intergenic
1114137803 14:19872618-19872640 ATGTGTATATATATATAAATAGG - Intergenic
1114137804 14:19872648-19872670 ATGTGTATATATATATAAATAGG - Intergenic
1114145132 14:19966692-19966714 TTGCTTGTAAGAATGTAAATTGG + Intergenic
1114873585 14:26687740-26687762 TGGTGTGTATGTGTGTGAACAGG + Intergenic
1115027145 14:28758918-28758940 GCGTGTGTATGCATATAAATAGG + Intergenic
1115353580 14:32423349-32423371 TTGTGTGTGTGTGTGGAGATGGG + Intronic
1115759470 14:36564107-36564129 CTGTTAGTAGGTATGTAAATTGG + Intergenic
1116110421 14:40572649-40572671 TTGTGTGTATGGATATTAACAGG - Intergenic
1116185708 14:41598545-41598567 CTATGTGTGTGTATGTAAATAGG + Intergenic
1116284431 14:42953867-42953889 GTGTGTGTATGTATGTATGGAGG + Intergenic
1116350075 14:43850105-43850127 TTGTGTGTTTTTGTGTAATTTGG + Intergenic
1116375765 14:44198413-44198435 GTGTGTGTATATATATAAACCGG + Intergenic
1116428918 14:44822903-44822925 TTGAGTGCATGTATGTATTTAGG - Intergenic
1117364714 14:55014655-55014677 TTTTTTGTATGTGTGTAGATAGG - Intronic
1117438940 14:55742648-55742670 GTGTGTGTGTGTGTGTGAATAGG + Intergenic
1117588078 14:57234376-57234398 TTGTGTGTATGTGTGTGGGTGGG - Intronic
1117784888 14:59272649-59272671 ATGTATGTATGTATGTATGTAGG + Intronic
1117907316 14:60604033-60604055 GTGTGTGAATATATATAAATAGG - Intergenic
1117950261 14:61075821-61075843 GTGTGTGTGTGTATGTATTTGGG + Intronic
1118306120 14:64657064-64657086 TTTTGTGTGTGTGTGTAAATTGG + Intergenic
1118727235 14:68637797-68637819 GTGTGTGTGTGTATGTGAAGAGG - Intronic
1119274216 14:73338869-73338891 CTGTGTGTTTATATGTAAAGTGG - Intronic
1120120257 14:80670411-80670433 CTGTGTGTATGTATATAAATAGG - Intronic
1120269428 14:82292515-82292537 TTTTATGTTTGTATGTAAACTGG - Intergenic
1120311686 14:82836659-82836681 GTGTGTGTGTGTATATATATAGG - Intergenic
1120350552 14:83352361-83352383 GTGTGTGTATATATGTAAAGGGG - Intergenic
1120353263 14:83392046-83392068 GTGTGTGTATGGATGTGAAAGGG + Intergenic
1120391301 14:83911690-83911712 TTGTTTCTTTGTATTTAAATTGG - Intergenic
1120428270 14:84378869-84378891 ATGTGTGTGTGTATATATATAGG + Intergenic
1120611259 14:86644909-86644931 AGATGTGTATTTATGTAAATTGG + Intergenic
1120614603 14:86688310-86688332 GTGTGTGTAGGTGTGTATATGGG - Intergenic
1120777611 14:88454633-88454655 TTGTGTGTGTGTGTGTAGATGGG - Intronic
1121345909 14:93135796-93135818 TTGTGTGTGTGTATGTGGAGGGG + Intergenic
1121809917 14:96875929-96875951 GTGTGTGTATAAATGTATATAGG - Intronic
1121849219 14:97204119-97204141 GTGTGTGTGTGTGTGTAAATAGG - Intergenic
1122003210 14:98681722-98681744 ATGTATGTATGTATGTACAGAGG - Intergenic
1122021474 14:98841298-98841320 GTGTGTGTATGTGTATATATGGG + Intergenic
1122439895 14:101723660-101723682 TAGTTTATATGTATGTATATGGG - Intergenic
1122708627 14:103638816-103638838 GTGTGTGTATGTATGAACATAGG + Intronic
1123055897 14:105570054-105570076 TTGTGTGTGTGAATGTGTATAGG - Intergenic
1123080254 14:105689526-105689548 GGGTGTGTATGTATGTACACGGG - Intergenic
1123080323 14:105690191-105690213 TTGTGTGTGTGAATGTGTATAGG - Intergenic
1123158068 14:106249695-106249717 TTTTGTATTTGTATATAAATTGG - Intergenic
1123432656 15:20231763-20231785 GTGTGTGTATGTGTGTAGAGAGG - Intergenic
1123495745 15:20823624-20823646 TTGTGTGTGTGTGTGTGACTAGG - Intergenic
1123552231 15:21392716-21392738 TTGTGTGTGTGTGTGTGACTAGG - Intergenic
1123584924 15:21750641-21750663 ATGTATGTATGTATGTATGTAGG + Intergenic
1123588475 15:21830113-21830135 TTGTGTGTGTGTGTGTGACTAGG - Intergenic
1123689895 15:22829613-22829635 ATGTGTCTATGTATGCTAATTGG - Exonic
1123830477 15:24131107-24131129 GTGTCTGTATGTGTGTAAAATGG + Intergenic
1123841338 15:24250562-24250584 GTGTGTGTATGTGTGTAAAATGG + Intergenic
1123850728 15:24353713-24353735 GTGTGTGTATGTGTGTAAAATGG + Intergenic
1123855608 15:24407953-24407975 GTGTGTGTATGTGTGTAAAATGG + Intergenic
1123864138 15:24500134-24500156 GTGTGTGTATGTGTATAAAATGG + Intergenic
1123915090 15:25016392-25016414 TTGTGTGTGTATGTGTATATAGG + Intergenic
1124024373 15:25951196-25951218 TTGTGTGTGTGTGTGGAGATGGG + Intergenic
1124080054 15:26485319-26485341 TTGTGTGTGTGTGTGTACATGGG + Intergenic
1124091860 15:26612940-26612962 TTGTGTGTGTGTGTGAAGATGGG - Intronic
1124190132 15:27567519-27567541 ATGTATGTATGTATTTCAATAGG + Intergenic
1124250906 15:28106163-28106185 GTGTGTGTATGTATGTGTCTGGG + Intergenic
1124407006 15:29402312-29402334 GTGTGTGTATATATGTATATTGG + Intronic
1124483724 15:30098584-30098606 GTGTGTGTGTGTATGTATATGGG + Intergenic
1124519855 15:30398642-30398664 GTGTGTGTGTATATGTATATGGG - Intergenic
1124538799 15:30567579-30567601 GTGTGTGTGTATATGTATATGGG + Intergenic
1124759852 15:32439992-32440014 GTGTGTGTGTGTATGTATATGGG - Intergenic
1125880215 15:43186934-43186956 TTCTGTGTATGTGTGTATATTGG + Intronic
1125932566 15:43611024-43611046 GTGTGTGTGTGTGTGTAAGTGGG + Intronic
1125945664 15:43710486-43710508 GTGTGTGTGTGTGTGTAAGTGGG + Intergenic
1126028267 15:44470425-44470447 CTGTGTGTATATATTTACATTGG + Intronic
1126117122 15:45218319-45218341 TTGTGTGTGTGTGTAGAAATGGG + Intergenic
1126430194 15:48575349-48575371 ATGTATGTATGTATGTATTTAGG + Intronic
1127101362 15:55568352-55568374 GTGTGTGTGTGTCTGTAAATGGG + Intronic
1127348272 15:58124042-58124064 ATGTGTGTATATATGTATAAAGG + Intronic
1127360004 15:58237042-58237064 GTGTGTGTGTGTGTGTGAATGGG + Intronic
1127823810 15:62684954-62684976 TTGTGTGAATGTATATATCTAGG + Intronic
1128531729 15:68455886-68455908 GTGTGTGTGTGTATGTGAAATGG + Intergenic
1128961347 15:72008459-72008481 GTGTGTGTGTGTGTGTGAATGGG + Intronic
1129421448 15:75430663-75430685 TTGTGTTTATATTTTTAAATTGG - Intronic
1129571609 15:76691646-76691668 TTGTGCTTTTGTTTGTAAATGGG - Intronic
1129669527 15:77599464-77599486 TTGTTTTTATGTCTGTACATCGG + Intergenic
1129866022 15:78909465-78909487 TTGTGTGTTTGTGTGTGAAGAGG + Intergenic
1130437916 15:83920626-83920648 CTGTGTGTATGTGTGTATTTTGG + Intronic
1130518211 15:84642471-84642493 TTGTGTGTGTGTGTGTAACAGGG + Exonic
1130858114 15:87859983-87860005 GTGTGTGTATGTATGGACATAGG - Intronic
1130919184 15:88329897-88329919 TTGTGTGTGTGTGTGTAGACGGG - Intergenic
1131026471 15:89146392-89146414 GTGTGTGTACGTATGTATATGGG + Intronic
1131082121 15:89545681-89545703 ATGTGTGTATGAATGTAATCAGG + Intergenic
1131484133 15:92806568-92806590 TAGTGTGTATGTATGTAGGTAGG + Intronic
1131484136 15:92806606-92806628 TAGTGTGTATGTATGTAAGTAGG + Intronic
1131619413 15:94051365-94051387 GTGTGTGTGTGTATGTATTTGGG - Intergenic
1131737816 15:95352596-95352618 TTATGAGTATTTATGTGAATGGG - Intergenic
1131893100 15:96995752-96995774 GTGTGTGTATATATATATATGGG + Intergenic
1131980356 15:97988259-97988281 GTGTGTGTATGTGTGTGTATGGG + Intergenic
1132180413 15:99748699-99748721 TTGTGTGTATGTGTGTGTGTAGG + Intergenic
1132975857 16:2710901-2710923 GTGTGTGTATGTGTGCACATGGG + Intergenic
1133392304 16:5420385-5420407 GTGTGTGTGTGTGTGTATATGGG - Intergenic
1133504956 16:6402645-6402667 GTGTGTGTATGTGTTTACATAGG - Intronic
1133542771 16:6772498-6772520 GTTTGTGTTTGTATGTATATGGG + Intronic
1133542781 16:6772566-6772588 ATTTGTGTGTGTATGTATATGGG + Intronic
1133610763 16:7431410-7431432 GTGTGTGTGTGTGTGTAGATGGG + Intronic
1134037237 16:11040300-11040322 TTGTGGGTAGGTATGGAAACAGG + Intronic
1134162276 16:11901189-11901211 TACTGTGTATGTATGAAGATAGG - Intronic
1134168186 16:11947261-11947283 GTGTGTGTGTGTGTGTACATAGG + Intronic
1134416860 16:14051249-14051271 GTGTGTGTCTGTATGTCTATGGG - Intergenic
1134430071 16:14195418-14195440 GTGTGTGTATATATATACATAGG + Intronic
1134852467 16:17491708-17491730 TTGTGTGTTTGTGTGTGAATGGG + Intergenic
1135165403 16:20134640-20134662 GTGTGTGTATGTGTGTACAGGGG + Intergenic
1135253303 16:20919388-20919410 TTGTTGGTAGGAATGTAAATTGG + Intronic
1135308314 16:21385974-21385996 GTGTGTGTTTGTATGTAAGATGG + Intergenic
1135544176 16:23354751-23354773 TTGTGTGAATCTATGTATATGGG + Intronic
1135803631 16:25522347-25522369 GTGTGTGTGTGTATGTGTATGGG - Intergenic
1136278898 16:29196470-29196492 TTGTGTGTATTTATTTTTATTGG - Intergenic
1136305058 16:29365109-29365131 GTGTGTGTTTGTATGTAAGATGG + Intergenic
1136587552 16:31197164-31197186 GTGTGTGTGTGTATATATATAGG - Intergenic
1137580009 16:49627904-49627926 TGGTGGGTGTGTATGTAGATGGG - Intronic
1137580079 16:49628212-49628234 GTGTGAGTATGTAGATAAATGGG - Intronic
1137901029 16:52269674-52269696 ATGTGTGTGTGTATATAAAATGG - Intergenic
1137978312 16:53049344-53049366 GTGTGTGTGTGTGTGTAAACAGG + Intergenic
1138334727 16:56244161-56244183 TTGAGTGTAGGCACGTAAATGGG + Intronic
1138364481 16:56462866-56462888 TGGTGTGTATGTATGTTATGGGG - Intronic
1138660391 16:58513182-58513204 GTGTGTGTGTGTGTGTACATCGG + Exonic
1138762089 16:59556883-59556905 GTGTGTGTATGTGTGTGTATTGG - Intergenic
1138868719 16:60853567-60853589 GTGTGTGTGTGTATCTAAAGGGG - Intergenic
1138918542 16:61498341-61498363 TTGTGTGTGTGCATGCATATGGG - Intergenic
1138946373 16:61855543-61855565 ATGTGTATAGGTATGTCAATAGG + Intronic
1138957874 16:61992954-61992976 TTGTGTGTGTGTATGGAGGTGGG + Intronic
1139074210 16:63423734-63423756 TTGTGTGTGTGTATCTAAGTGGG - Intergenic
1139114026 16:63927118-63927140 TTATGTGCATGTATGTATGTGGG + Intergenic
1139168674 16:64603229-64603251 TTGTGTGCATGTGTGTTATTTGG - Intergenic
1139171123 16:64630388-64630410 GTGTGTGTGTGTATGTGAAGAGG - Intergenic
1139255815 16:65541351-65541373 ATGTGTGTATGTATATATGTAGG + Intergenic
1139265372 16:65633650-65633672 GTGTGTGTGTGTGTGAAAATGGG - Intergenic
1139314104 16:66053420-66053442 GTGTGTGTGTGTGTGTATATTGG - Intergenic
1139314105 16:66053448-66053470 AAGTGTGTATTTATGTAGATAGG - Intergenic
1139314108 16:66053498-66053520 TTATGTAGATGTATGTATATAGG - Intergenic
1139314110 16:66053568-66053590 GTGTGTGTAGGTAGGTAAATAGG - Intergenic
1139314117 16:66053602-66053624 ATGTGTCTATGTATGTAGCTAGG - Intergenic
1139919272 16:70449070-70449092 TTGTGTGTATGTGTGTGTAATGG + Intergenic
1140344991 16:74204794-74204816 TGGTGAGTATATATGGAAATGGG + Intergenic
1140842905 16:78858158-78858180 GTGTGTGTGTGTGTATAAATTGG + Intronic
1140843957 16:78868954-78868976 GTGTGTGTCTGTGTGTACATGGG - Intronic
1141216414 16:82028866-82028888 ATGTGTGTATATATATAGATGGG - Intergenic
1141216417 16:82028930-82028952 ATGTGTGTATATATGTAGATGGG - Intergenic
1141257145 16:82412824-82412846 ATGTGTATGTGTATGTACATAGG - Intergenic
1142083296 16:88162589-88162611 TTGTGTGTATTTATTTTTATTGG - Intergenic
1142257735 16:89023427-89023449 GTGTGTGTATGTGTGTGACTGGG - Intergenic
1203106491 16_KI270728v1_random:1365304-1365326 GTGTGTGTGTGTATGTACAGTGG - Intergenic
1203127023 16_KI270728v1_random:1597064-1597086 GTGTGTGTGTGTATGTACAGTGG + Intergenic
1142778454 17:2161038-2161060 TTGTATGTATGTATGTAGGTAGG + Intronic
1143168083 17:4909009-4909031 CTGTGTGTATGTGTGTATCTGGG - Intergenic
1143280118 17:5747663-5747685 TGGTGTGAATGTATGTGAGTGGG - Intergenic
1143471006 17:7175424-7175446 TTGTGTGAATGTGTGTATGTGGG - Intronic
1143583062 17:7837410-7837432 TTGTGTGTATGCGGGTGAATCGG + Intergenic
1143754949 17:9060002-9060024 CGGGGTGTATGTATGCAAATGGG + Intronic
1143929107 17:10402150-10402172 TTTTGTGTATATATATATATGGG + Intronic
1144182865 17:12769287-12769309 ATGTATGTATGTATCTTAATGGG - Intergenic
1144744607 17:17605494-17605516 TTTTCAGTGTGTATGTAAATGGG + Intergenic
1144759178 17:17697730-17697752 TTGTGTGTCTGTTTGTCACTGGG + Intronic
1144922212 17:18773496-18773518 TTGTGTGTGTGTATGTAGGTGGG + Intronic
1145049877 17:19651015-19651037 GTGTGAGTATGTGTGTATATAGG + Intronic
1145192990 17:20863422-20863444 TTGTTTCTATGTAAATAAATAGG - Exonic
1145754525 17:27381024-27381046 GCGTGTGTGTGCATGTAAATCGG - Intergenic
1145898093 17:28472364-28472386 GTGTGTGTATGTATGTTGAACGG - Intronic
1145908455 17:28529006-28529028 TTCTCTGGATGTATATAAATGGG + Intronic
1146338285 17:31994712-31994734 TTGTGTGCAGGTAGGTAAAAAGG + Exonic
1146369238 17:32254641-32254663 TTGTGAGGATGTAGGTAAAAAGG - Intergenic
1146381332 17:32330521-32330543 TTGTATGTATGTAGCTACATAGG + Intronic
1146492888 17:33294568-33294590 CTGTGTGGATGTATGTATGTGGG - Intronic
1147012864 17:37465575-37465597 GTGTGTATATTTATATAAATAGG + Intronic
1147126794 17:38375726-38375748 GTCAGTTTATGTATGTAAATTGG + Intronic
1147190380 17:38734969-38734991 GTGTGTGTATGTGTGGAAAATGG - Exonic
1147311030 17:39596373-39596395 CTGTGTGTATGTGTGTATGTGGG + Intergenic
1147968362 17:44206407-44206429 GTGTGTGTGTGTGTGTAAAGGGG - Exonic
1148055482 17:44792056-44792078 CTGTGTGTGTGTGTGGAAATGGG + Intergenic
1148576495 17:48715303-48715325 TGGTGTTTATCTAGGTAAATAGG + Intergenic
1148842804 17:50509564-50509586 GTGTGTGTGTGTTTGTAAACAGG + Intronic
1149137395 17:53384926-53384948 GTGTGTGTATATATATATATAGG - Intergenic
1149238229 17:54617989-54618011 GTGTGTGTGTGTGTGTAAACTGG - Intergenic
1149261560 17:54885485-54885507 GTGTGTGTATATATATAAAGGGG - Intergenic
1149381473 17:56098395-56098417 TTGTGTGTATGTGTGTAGCAGGG - Intergenic
1149492992 17:57098575-57098597 GTATGTGTATGTATGAAAAGAGG + Intronic
1149799475 17:59553633-59553655 GTGTGTGTGTGTGTGTATATAGG + Intergenic
1149823247 17:59801242-59801264 TTGTGTGTGTGTATGTTGAAGGG + Intronic
1150053595 17:61990277-61990299 GTGTGTGTATGTATATATAGTGG - Intronic
1150359895 17:64522629-64522651 ATGTATGTATGTATATAAAATGG + Intronic
1150551099 17:66211035-66211057 TTGTGTTTATGAATTTAAAATGG + Intergenic
1150867114 17:68864138-68864160 GTGTGTGTGTGTATATATATAGG - Intergenic
1150874380 17:68952893-68952915 TTCTGGGTATGTCTGTATATGGG + Intronic
1151066313 17:71154224-71154246 GTGTGTGTGTGTGTGTGAATAGG - Intergenic
1151099455 17:71540076-71540098 GTGTGTGTATGTATGTGAGTAGG - Intergenic
1151174123 17:72273111-72273133 GTGTGTGTGTGTGTGTAAACTGG - Intergenic
1151498994 17:74476967-74476989 GTGTGTGTATGTGGGGAAATTGG + Intronic
1151638910 17:75374555-75374577 TAGTGTGTGTGTGTGTCAATAGG - Intronic
1151856068 17:76722880-76722902 TTGTTTGTGTTTCTGTAAATTGG - Intronic
1151881903 17:76900977-76900999 GTGTGTGCATGTGTGTACATGGG + Intronic
1152367116 17:79862704-79862726 TGGTGTGTGTGTATTTATATGGG - Intergenic
1153179596 18:2418006-2418028 TTGTGTGTATTTTTTTAATTTGG - Intergenic
1153325526 18:3815410-3815432 TTGTGTGTATGTGTGTGCACGGG - Intronic
1153484327 18:5581463-5581485 TTTTGTTTATGTAAGTAAGTAGG + Intronic
1154462247 18:14604132-14604154 TTGCTTGTAAGAATGTAAATTGG + Intergenic
1155327061 18:24675212-24675234 GTCTGTGTATGTATACAAATAGG + Intergenic
1155344007 18:24840793-24840815 ATGTGTGTATGTGTGTTTATGGG + Intergenic
1155373137 18:25125645-25125667 GTGTGTGTATGTATGTGTAATGG + Intronic
1155387632 18:25297066-25297088 GTGTGTGTATGTGTGTGTATGGG - Intronic
1155443168 18:25883246-25883268 TTGAGTGAATGAATGTCAATTGG - Intergenic
1155611265 18:27670524-27670546 GTGTGTGTGTGTGTGTAAACCGG + Intergenic
1155638775 18:27987139-27987161 ATGTATGTATGTATGTATATTGG - Intronic
1155643185 18:28044865-28044887 GTGTGTGTGTGTGTGTAAACAGG + Intronic
1155728318 18:29118060-29118082 ATGTGTGTATGTATGTATACAGG - Intergenic
1155932462 18:31721898-31721920 GTGTGTGTATGTGTGTATGTGGG + Intergenic
1156380045 18:36550208-36550230 TTGTGTATATATATATATATAGG + Intronic
1156454269 18:37284299-37284321 GTGTGTGTGTGTATGTGCATTGG - Intronic
1156527595 18:37781254-37781276 GTGTGTGTATGTGTGTCTATAGG - Intergenic
1156565663 18:38186975-38186997 TTGTGTGTATGTGTGTATGGAGG - Intergenic
1156739625 18:40308784-40308806 ATGTATGTATGTATGTATGTAGG + Intergenic
1156813363 18:41278697-41278719 GTGTGTGTAAGTATGTGTATAGG - Intergenic
1156951835 18:42910159-42910181 TTGTTTGTCTGTATGTATCTTGG - Intronic
1156973864 18:43192774-43192796 GTGTGTGTGTGTATATATATGGG - Intergenic
1156977421 18:43239370-43239392 ATGTGTGTATATATGTCAATAGG - Intergenic
1157067078 18:44364942-44364964 TTGTGTCTGTGTATGTTAATTGG + Intergenic
1157213937 18:45766527-45766549 TTGTTTGTATGTATGTATTTAGG - Intergenic
1157255896 18:46139031-46139053 ATGTGTGCATTTATGTAAAGTGG + Intergenic
1157272414 18:46286464-46286486 TTTTTTGTAGGTATGTACATAGG + Intergenic
1157441892 18:47717951-47717973 GTGTGTGTGTGTGTGTAAATAGG + Intergenic
1158371871 18:56815829-56815851 TTGCATGTATATATGTACATGGG - Intronic
1158387047 18:57006897-57006919 ATGTGTGTATGTATGTATACAGG + Intronic
1158397871 18:57093826-57093848 TTGTGTGTGTGTTTGTGTATAGG - Intergenic
1158518055 18:58147118-58147140 TTGTGTGTCTGTGTGTGCATTGG + Intronic
1158671764 18:59481491-59481513 TTTTGTGTATGTGTGTAGTTAGG - Intronic
1158851508 18:61499519-61499541 GTGTGTGTGTGTATATATATAGG - Intronic
1158965055 18:62615208-62615230 CTGTGTGTGTGTGTGAAAATGGG + Intergenic
1159027529 18:63198389-63198411 ATGTGTGTCTGTGTGTCAATGGG - Intronic
1159034053 18:63260231-63260253 GTGTGTGTATGTATGGAATGAGG - Intronic
1159127101 18:64236484-64236506 TTGTATGTGTGTATGTAAGCAGG + Intergenic
1160146919 18:76372802-76372824 TTTTGTGTATGTAAGGCAATGGG - Intronic
1160164572 18:76498665-76498687 TTTTGTGTATAAATGGAAATTGG + Intergenic
1161772678 19:6239673-6239695 TTGTGTGTGTGTTTGTACACAGG - Intronic
1161838378 19:6663499-6663521 GTGTGTGTATGTGTGTAACCAGG + Intronic
1162015274 19:7842513-7842535 GTGTGTGCATGTCTGTGAATTGG + Intronic
1162308396 19:9889778-9889800 CTGTGTGTATGTGTGTGAAGGGG + Intronic
1162340814 19:10090612-10090634 TTGTGTGTGTGTGTGGAGATGGG + Intronic
1163099876 19:15088477-15088499 TTGTGTGTGTGTGTGGAGATAGG - Intergenic
1164309206 19:24031431-24031453 TTGTATGTATGTATTTGTATAGG + Intergenic
1164498504 19:28792579-28792601 TTCTCTGTGTGTATGTTAATTGG + Intergenic
1165267154 19:34669708-34669730 GTGTGTGTGTGTGTGTAAGTGGG - Intronic
1165439998 19:35820051-35820073 GTGTGTGTGTGTGTGTACATTGG - Intergenic
1165697365 19:37910943-37910965 GTGTGTGTATGTATGTGATTGGG + Intronic
1165702102 19:37946302-37946324 TTGTGTGTGTGTGTGGAGATGGG + Intronic
1166655189 19:44606050-44606072 TTGTGTGTGTGTGTGGAGATGGG - Intergenic
1166689847 19:44815831-44815853 GTGTGTGTGTGTGTGCAAATGGG - Intronic
1166887252 19:45969593-45969615 ATGTATGTATGTCTGTATATGGG + Intronic
1167091903 19:47350043-47350065 GTGTGTGTGTGTATGTACATAGG + Intronic
1167132924 19:47599471-47599493 TTGTGTGTATTTTTTTGAATAGG + Intergenic
1168471663 19:56645283-56645305 ATGTTTGTATGTGTGTATATGGG + Intronic
1202663903 1_KI270708v1_random:99041-99063 TTGTGTGTGTGTGTGTAGGTGGG - Intergenic
924981967 2:231475-231497 ATATGTGTATGTATATATATGGG - Intronic
925029753 2:641246-641268 GTGTGTGTGTATATGTGAATGGG - Intergenic
925080731 2:1062881-1062903 GTGTGTATATGTATATATATGGG - Intronic
925130866 2:1493186-1493208 TTGTGTGTGTGTGTGTGAGTGGG + Intronic
925149378 2:1604246-1604268 GTGTGTGTCTGTGTGTATATTGG - Intergenic
925393612 2:3516754-3516776 TTGTTTGTATGTATGACAAAAGG + Intronic
925472586 2:4178686-4178708 ATTTGTGTATGTATGTATATAGG - Intergenic
925523997 2:4779601-4779623 TTGTGTGTGTGTATGAAAGATGG - Intergenic
925880909 2:8351565-8351587 GTGTGTGTGTGTGTGTATATAGG - Intergenic
926532372 2:14065521-14065543 TTTTGTGTATGCATATGAATAGG + Intergenic
926732187 2:16044140-16044162 GTGTGTGTCTGAATGTTAATAGG - Intergenic
926788508 2:16545157-16545179 TATTGTGTATGTGTGTATATAGG + Intergenic
927339019 2:21959609-21959631 GTGTGTGTGTGTATGTATTTTGG + Intergenic
927364815 2:22282318-22282340 GTGTGTGTATGAATATATATTGG + Intergenic
927416184 2:22883082-22883104 GTGTGTCTGTGTGTGTAAATGGG - Intergenic
927650681 2:24911718-24911740 GTGTGTGTGTGTATGAAGATGGG + Intronic
928276330 2:29903520-29903542 TTTTATGTATGTATGTAAGTAGG + Intronic
928628152 2:33162231-33162253 TTGTTCATATGTATGTGAATAGG + Intronic
928660419 2:33496202-33496224 TTATTTGTATGTCTTTAAATAGG + Intronic
928823285 2:35389416-35389438 TTGTGTGTATGTGTGTCTTTTGG - Intergenic
928859285 2:35836500-35836522 TTGTGTGTGTGTGTGTATGTGGG - Intergenic
929259236 2:39845962-39845984 GTGTGTGTGTGTATGTATGTGGG + Intergenic
929308172 2:40389919-40389941 GTGTGTGTGTGTCTATAAATTGG - Intronic
929359644 2:41070971-41070993 ATATGTATATGTATGTAAATTGG + Intergenic
929400625 2:41577179-41577201 TATTGTGTATGTATGGAAAAAGG + Intergenic
929904793 2:46036404-46036426 TTTTGTGTGTGTGTGGAAATAGG - Intronic
930003447 2:46877602-46877624 TGGTGTGTATGTGTGTGAGTGGG - Intergenic
930003450 2:46877633-46877655 TGGTGTGTATGTGTGTGAGTGGG - Intergenic
930003474 2:46877775-46877797 TGGTGTGTATGTGTGTGAGTGGG - Intergenic
930211603 2:48644633-48644655 CTGTTTGTATGAATGTATATTGG - Intronic
930422612 2:51172817-51172839 GTGTGTGTATATATATAAAATGG + Intergenic
930454823 2:51593274-51593296 TTATGTGTAAGTATGCATATGGG + Intergenic
930832977 2:55765033-55765055 GTGTGTGTGTGTTTTTAAATGGG + Intergenic
930924164 2:56796198-56796220 TTATGTGTATGTGTGTGTATAGG + Intergenic
930965794 2:57324379-57324401 GTGTGTGTGTGTGTGTATATAGG - Intergenic
931051866 2:58424836-58424858 GTGTGTGTATGTGTGTGTATCGG + Intergenic
931417981 2:62099446-62099468 TTGCGAGTATTTATGTAAATAGG - Intronic
931555620 2:63500467-63500489 GTGTGTGTGTGTGTGTAAAGTGG + Intronic
931937372 2:67214138-67214160 TGGTGTGTATGTATGTTGGTGGG - Intergenic
931937384 2:67214207-67214229 ATGTGGGTGTGTATGTAAGTCGG - Intergenic
931955502 2:67419401-67419423 GTGTGTGTGTGTGTGTAGATAGG - Intergenic
931978816 2:67672107-67672129 TTGTGTGTGTGTATGTGAGGTGG - Intergenic
931978847 2:67672556-67672578 GTGTGTGTATGTATGTGAGGTGG - Intergenic
932392604 2:71410380-71410402 GTGTGTGTGTGTGTGTAGATGGG + Intronic
932417786 2:71584172-71584194 GTGTGTGTGTGTGTGTGAATGGG + Intronic
932626006 2:73296259-73296281 GTGTGTGTATGTGTGTCCATTGG - Intergenic
932898892 2:75675286-75675308 TTGTATGTATATATTTAAAATGG + Intronic
933040543 2:77459798-77459820 TTGTTTGTTTGTCTGTACATTGG - Intronic
933043887 2:77508753-77508775 TTGTGTATAAGTATTTATATTGG - Intronic
933064459 2:77776604-77776626 TTGTGTGTGTGTATTTAACAGGG - Intergenic
933392337 2:81687298-81687320 TTTTTTGTATGTAAGTTAATAGG + Intergenic
933449899 2:82435229-82435251 GTGTGTGTGTGTCTGTAAAGAGG - Intergenic
933558212 2:83858295-83858317 GTGTGTGTGTGTTTGTGAATGGG + Intergenic
933605030 2:84373744-84373766 ATGTGTTTGTGTATGTAAGTTGG - Intergenic
934124002 2:88868569-88868591 ATGTGTATATGTATGTATGTAGG + Intergenic
934162455 2:89264030-89264052 GTGTGTGTATGCATATATATAGG - Intergenic
934204819 2:89918320-89918342 GTGTGTGTATGCATATATATAGG + Intergenic
934215788 2:90030357-90030379 GTGTGTGTGTGTATGTTTATGGG + Intergenic
934463194 2:94233581-94233603 ATGTGTGTATGTGTGTGTATAGG + Intergenic
934600999 2:95658454-95658476 GTGTGTGTGTGTAAGTAAAGAGG - Intergenic
934870974 2:97865074-97865096 TTATGTGTATGTATGGAACTGGG + Intronic
935103438 2:100018026-100018048 GTGTGTGTATATATATATATAGG + Intronic
935423024 2:102890065-102890087 GTGTGTGTATGTGTGTATGTAGG + Intergenic
935487111 2:103671551-103671573 TTGTGTGTATATTTGTGAGTAGG - Intergenic
935502675 2:103860053-103860075 GTGTGTGTGTGTAAGTCAATAGG - Intergenic
935734529 2:106096194-106096216 GTGTGTGTGTGTATGTATGTGGG + Intronic
935754761 2:106268378-106268400 TTGCTTGTGAGTATGTAAATTGG + Intergenic
935766217 2:106370327-106370349 ATGTATGTATATATGTATATAGG + Intergenic
935841623 2:107118244-107118266 TTATGTGTGTGTATGTATGTGGG + Intergenic
936169577 2:110156752-110156774 TTGTGTGTGTGTATGTGTTTTGG + Intronic
936534369 2:113300602-113300624 GTGTGTGTGTGTAAGTAAAGAGG - Intergenic
936545654 2:113390836-113390858 GTGTGTGTTTGTATGGAACTAGG + Intergenic
936628219 2:114171880-114171902 GTGTGTGTGTGTGTGTTAATGGG + Intergenic
936745016 2:115565141-115565163 ATGTGTGTATATATGTATGTAGG + Intronic
936858299 2:116986494-116986516 ATGTGTGTGTGTATATATATAGG + Intergenic
937103199 2:119287404-119287426 CGGTGTGTATGTATGTACATGGG - Intergenic
937229585 2:120389715-120389737 TTTTTTTTTTGTATGTAAATGGG - Intergenic
937624745 2:124031130-124031152 GTGTGTGTGTGTATGTATAGCGG - Intronic
937648170 2:124288891-124288913 TTGTGTGAATAAATGAAAATTGG + Intronic
937725935 2:125166622-125166644 GTGTGTGTCTGTATATATATGGG - Intergenic
937739321 2:125332020-125332042 TTTTGTGTATCTATTGAAATGGG - Intergenic
937766110 2:125662334-125662356 GTGTGTGTATGTGTGTGTATAGG - Intergenic
938170002 2:129067099-129067121 ATGTGTGTCTGTATGTGAATGGG + Intergenic
938170005 2:129067135-129067157 ATGTGTGGATGTATGTGAATGGG + Intergenic
938241511 2:129745780-129745802 TTTTGGGTATGTATGTACATAGG - Intergenic
939194289 2:138953588-138953610 TTGTGTGCATGTGTGTAATGTGG + Intergenic
939218986 2:139278099-139278121 TTGTGTGTGTGTGTGTATGTGGG + Intergenic
939342827 2:140922271-140922293 GTGTGTGTGTGTATACAAATAGG - Intronic
939519141 2:143207471-143207493 ATGTGTGTGTGTGTGTCAATGGG - Intronic
939798268 2:146675367-146675389 TTCTGTGTATGTATGTGTTTTGG - Intergenic
939819058 2:146933449-146933471 TTGTTGGTAGGAATGTAAATTGG + Intergenic
939831502 2:147077787-147077809 TTTTGTGTATGGTTGTAGATCGG - Intergenic
940000131 2:148959396-148959418 TTGTGTATGTGTATAGAAATTGG - Intronic
940109872 2:150139881-150139903 ATGTGTGTGTGTATGAGAATGGG - Intergenic
940524629 2:154797584-154797606 ATATATGTATGTATGTATATTGG + Intronic
940722819 2:157300225-157300247 TGTTCTGTATGTATGTAAAAGGG + Intronic
941097759 2:161259907-161259929 GTGTGTGTGTGTATGTGTATGGG + Intergenic
941297722 2:163760921-163760943 TAGAATGTATGTATGTAATTAGG - Intergenic
941390595 2:164908923-164908945 GTGTCTGTATGTAAGTAATTTGG - Intronic
941434400 2:165451204-165451226 TTGTGTGTATGTCTTTTACTGGG + Intergenic
941467111 2:165841130-165841152 GTGTGTGTGTGTGTGTAAAATGG - Intergenic
941474803 2:165937625-165937647 TTTGGTGTATCTATGTGAATAGG + Intronic
941733848 2:168950126-168950148 GTGTGTGTATATATATATATGGG - Intronic
941855099 2:170222928-170222950 TTGTGTATGTGTGTGTAAACAGG - Intronic
942161176 2:173189494-173189516 TTGAGTGTTAATATGTAAATAGG - Intronic
942306493 2:174612275-174612297 TTTTGTGTTTGTATTTAAAATGG + Intronic
942531528 2:176915315-176915337 GTGTGTGTATGTGTGTATTTTGG - Intergenic
942974842 2:182003708-182003730 TAGTGTGTGTGTATGTAAAATGG + Intronic
943028815 2:182661891-182661913 ATGTGTGTCTTTATGTGAATTGG - Intergenic
943107861 2:183569924-183569946 GTGTGTGTGTGTATTTAAACTGG - Intergenic
943191493 2:184684325-184684347 TTGTGTTTATGTAAATGAATAGG + Intronic
943205571 2:184889687-184889709 TTGTGTGTATGTGTTTTGATAGG + Intronic
943207319 2:184917673-184917695 GTGTGTGTGTGTATATATATAGG + Intronic
943295029 2:186127482-186127504 GTGTGTGTGTGTGTGTATATAGG - Intergenic
943429952 2:187787022-187787044 TAATTTGTATCTATGTAAATGGG - Intergenic
943555079 2:189393179-189393201 TTGTGTGTTTTTCTGTAAAAAGG - Intergenic
943562539 2:189481299-189481321 TTCGGTGCATGTATATAAATAGG + Intergenic
943827759 2:192417310-192417332 ATGTGTGTATGTATTTTACTGGG - Intergenic
943895465 2:193352598-193352620 GTTTGTGTGTGTGTGTAAATTGG - Intergenic
944076611 2:195739647-195739669 GTGTGTGTATGTATATACAGTGG + Intronic
944239615 2:197473172-197473194 TTGTGTGGATGTATGTAGGTGGG - Intronic
944273595 2:197809828-197809850 GTGTGTGTGTGTGTTTAAATAGG + Intronic
944541972 2:200762717-200762739 ATGTGTGTATGAATACAAATGGG - Intergenic
944905403 2:204257036-204257058 GTGTGTGTGTGTGTGTAAAAAGG - Intergenic
944959304 2:204852323-204852345 TTGTATGTATATATGTATATAGG + Intronic
944967254 2:204949140-204949162 TTCTGTGTTTCTATGGAAATGGG + Intronic
945283588 2:208060487-208060509 TTGTCTGTGTGTGTGTAAATGGG + Intergenic
945518353 2:210791713-210791735 TTGTGTGTGTGTGTGTGAGTGGG - Intergenic
945656136 2:212626326-212626348 TTGTTGGTAGGAATGTAAATTGG + Intergenic
945675903 2:212855382-212855404 TTGTGTGTGTGTGTGGAAAGAGG - Intergenic
946163736 2:217851347-217851369 CTGTGTGTGTGTATGTTGATTGG - Intronic
946165050 2:217858665-217858687 GTGTGTGTGTGTGTGTACATGGG - Intronic
946521632 2:220471111-220471133 GTGTGTGTATGTGTGTATAATGG + Intergenic
946524757 2:220506642-220506664 CTGTGTGTGTGTGTGTAAACTGG + Intergenic
946606325 2:221409230-221409252 GTGTTTGTATGTATGCAAATGGG - Intergenic
946707913 2:222476740-222476762 GTGTGTATATGTATGTATATAGG + Intronic
946707917 2:222476828-222476850 ATATGTGTATGTGTGTATATAGG + Intronic
946707924 2:222477085-222477107 ATTTGTGAATGTATGTATATAGG + Intronic
946707932 2:222477287-222477309 GTGTGTATATGTGTGTATATAGG + Intronic
946707934 2:222477355-222477377 ATATGTGTATGTGTGTATATAGG + Intronic
946707937 2:222477431-222477453 ATGTGTGAATGTATGTATATAGG + Intronic
946707940 2:222477559-222477581 ATGTGTGAGTGTATGTATATAGG + Intronic
946854593 2:223940361-223940383 GTGTATGTGTGTGTGTAAATTGG - Intronic
947078329 2:226368158-226368180 GTGTGTGTGTGTATATATATAGG + Intergenic
947110481 2:226713662-226713684 TTTTCTGTATGCAGGTAAATTGG + Intergenic
947432704 2:230044748-230044770 GTGTGTGTGTGTGTGTAGATGGG + Intronic
947466487 2:230352860-230352882 ATGTGTGTATATATGTATAATGG + Intronic
947478180 2:230470970-230470992 GTGTGTGTATATATGTATATTGG + Intronic
947492004 2:230603258-230603280 TTGTTGGTAGGAATGTAAATTGG + Intergenic
947492788 2:230610421-230610443 GTGTGTGTGTGTGTGTAAATGGG + Intergenic
947821637 2:233075603-233075625 GTGTGTGTGTGTGTGTATATAGG + Intronic
947883369 2:233541922-233541944 TTATGTTTATATATGTATATTGG - Intronic
947948356 2:234125982-234126004 GTGTGTGTATATATATAATTGGG + Intergenic
948006444 2:234612167-234612189 ATGTGTGTGTGTGTGTAAAGAGG + Intergenic
948292820 2:236839291-236839313 TTGTATGTAACTATGTAAATTGG - Intergenic
948569376 2:238907781-238907803 GTGTGTTTATGTGTGTAAGTGGG - Intronic
948585646 2:239017288-239017310 TTGTGTGTGTGTATGAGCATGGG + Intergenic
948585683 2:239017956-239017978 TTGTGTGTGTGTATGAGCATGGG + Intergenic
948989532 2:241546070-241546092 TGGTATGTATGTGTGTATATGGG - Intergenic
1169063462 20:2678509-2678531 TTGGGTGTATGTTTGTATGTGGG + Intergenic
1169269642 20:4189173-4189195 GTGTGTGTGTGTATGTAGGTAGG - Intergenic
1169973060 20:11291689-11291711 TTGTGTGTATGTGTAGAGATAGG - Intergenic
1170238309 20:14133002-14133024 GTGTGTGTGTGTGTGTATATGGG + Intronic
1170265211 20:14459510-14459532 ATGTGTGTATGTATGTAGGTAGG + Intronic
1170266593 20:14472860-14472882 TTTTGTGTATGTGTGTATGTAGG + Intronic
1170293099 20:14793183-14793205 GTGTGTGTGTGTGTGTAAAGTGG + Intronic
1170298274 20:14853187-14853209 GTGTGTGTGTGTGTATAAATGGG + Intronic
1170448494 20:16456432-16456454 GTGTGTGTGTGTATCTTAATTGG - Intronic
1170485497 20:16811739-16811761 GTGTGTGTCTGTATCTATATGGG + Intergenic
1170824916 20:19785265-19785287 GTGTGTGTGTGTATGTAGAGGGG - Intergenic
1170900580 20:20458713-20458735 GTGTGTGTATATATATATATAGG - Intronic
1170920003 20:20669154-20669176 TTGTGTCGATGTATTTTAATTGG + Intronic
1171167684 20:22986260-22986282 TTGGGTGTATGTATGTTTGTGGG + Intergenic
1172226497 20:33308479-33308501 GCGTGTGTATGTATGTGTATAGG - Intronic
1172226500 20:33308557-33308579 GCGTGTGTATGTATGTGTATAGG - Intronic
1172226503 20:33308635-33308657 GCGTGTGTATGTATGTGTATAGG - Intronic
1172226506 20:33308713-33308735 GTGTGTGTATGTATATGTATAGG - Intronic
1172237278 20:33386483-33386505 GTGTGTATATGTGTGTATATAGG + Intronic
1172300518 20:33846510-33846532 ATGTGTGTATGTATGTATTTTGG + Intronic
1172802843 20:37590300-37590322 CTGTGTGTATGGCTGTGAATGGG + Intergenic
1172912052 20:38417009-38417031 TTATATGTATATATGCAAATTGG - Intergenic
1172985565 20:38985588-38985610 TTGTGTTTTTGTATGAAAATGGG + Intronic
1173418983 20:42883857-42883879 ATGTGTGTATGCATGTCTATGGG - Intronic
1173491115 20:43482728-43482750 GTGTGTGTGTGTGTGTATATAGG - Intergenic
1173503710 20:43571264-43571286 ATGTGTGCATGCATGTACATAGG + Intronic
1173547404 20:43909452-43909474 GTGTGTGTGTGTATGTATGTAGG + Intergenic
1173547405 20:43909456-43909478 GTGTGTGTATGTATGTAGGAAGG + Intergenic
1173547828 20:43913117-43913139 TTGTGTGTATATATATAAATAGG + Intergenic
1173706330 20:45112942-45112964 CTGTGTGTATGTATCTATGTGGG - Intronic
1173880861 20:46411224-46411246 GTGTGTGTGTGTGTGTAATTGGG + Intronic
1173901384 20:46592260-46592282 TTTTATGTATGTATGTATGTAGG - Intronic
1174132157 20:48352812-48352834 TGGGGTGTATGTATGCACATGGG - Intergenic
1174738366 20:52986922-52986944 TTGTGTGTGTGTGTGTATGTAGG + Intronic
1175297965 20:57922227-57922249 ATGTGTGTATGTATGTGTCTGGG - Intergenic
1175474437 20:59260980-59261002 GTGTGTGTATGTATGTAAGGAGG - Intergenic
1175636320 20:60587212-60587234 TTTTGTGTATTTAGGTAAAAGGG - Intergenic
1175655258 20:60764376-60764398 GTGTGTGAATGTATGTATAGGGG - Intergenic
1175757083 20:61536698-61536720 ATGTGTATATGTATGTATGTAGG - Intronic
1175913841 20:62416603-62416625 TTGTGTGTTTGTCTGTAGATTGG + Intronic
1175959656 20:62629237-62629259 GTGTGTATATATATATAAATAGG + Intergenic
1176790456 21:13313360-13313382 TTGTTGGTAGGAATGTAAATTGG + Intergenic
1176812315 21:13554550-13554572 TTGCTTGTAAGAATGTAAATTGG - Intergenic
1177389288 21:20445781-20445803 GTGTGTGTGTGTATGTAAGAAGG + Intergenic
1177399791 21:20587894-20587916 GTGTGTGTATATATATATATGGG + Intergenic
1177560797 21:22750095-22750117 TTGTATGTATAAATTTAAATAGG - Intergenic
1177993637 21:28069222-28069244 GAGTGTGTATGTATGTATGTGGG + Intergenic
1178356978 21:31917681-31917703 GTGTGTGTATGTTTGGGAATGGG - Intronic
1178452939 21:32720987-32721009 TTGTGTATGTGTGTGTAAACTGG + Intronic
1178623585 21:34197419-34197441 GTGTATGTGTATATGTAAATTGG + Intergenic
1178956526 21:37027802-37027824 GTGTGTGTGTGTGTGTAGATAGG + Intergenic
1179171078 21:38973255-38973277 TTGTGTGAATGTATTTATAATGG + Intergenic
1180462926 22:15583229-15583251 GTGTGTGTCTGTGTGTAAGTGGG + Intergenic
1181057434 22:20266871-20266893 TTGTGTGCGTGTGTGTAACTTGG - Intronic
1181775383 22:25155536-25155558 TTTTGTGTATGTGTGTGCATTGG + Intronic
1182122236 22:27795712-27795734 GTGTGTGTGTGTATATATATAGG - Intronic
1183234453 22:36606924-36606946 ATGTGTGTATGTGTTTATATGGG + Intronic
1183721327 22:39563365-39563387 TTATGTGTGTGCCTGTAAATGGG + Intergenic
1184479944 22:44740494-44740516 GTGTGTGTGTGTGTGTAAGTGGG + Intronic
1184779421 22:46639170-46639192 GTGTGTGTGTGTATGTACAGTGG + Intronic
1184812536 22:46846310-46846332 TTGTATGTATGTTTGTCAGTGGG + Intronic
1184821000 22:46909285-46909307 GTGTGTGTGTGTATGTGTATAGG - Intronic
1184868953 22:47221182-47221204 ATGTGTGCATGTGTGTACATGGG - Intergenic
1185079751 22:48703124-48703146 TTGTGAGCATGCATGTAAATGGG + Intronic
1185396200 22:50590869-50590891 TTGTGTGTGTGTGTGTAGATGGG + Intronic
949140274 3:624698-624720 GTGTGTGTGTGTGTGTAATTAGG - Intergenic
949503565 3:4705030-4705052 GTGTGTGTATGTTTTTAAATGGG + Intronic
949585986 3:5437736-5437758 TTGTGTGTCTGTATGAAAAAGGG + Intergenic
949680056 3:6503206-6503228 GTGTGTGTATGTCTGTGTATAGG - Intergenic
949932063 3:9086577-9086599 ATGTGTGTGTGTATATATATAGG + Intronic
950919820 3:16683131-16683153 ATGTGGTTATGTATGTAAACAGG - Intergenic
951298030 3:20963318-20963340 GTGGTTTTATGTATGTAAATAGG - Intergenic
951368085 3:21809687-21809709 ATATGTGTATATATGTATATAGG - Intronic
951394214 3:22145094-22145116 ATGTATGTGTGTATGTACATAGG - Intronic
951681830 3:25302911-25302933 TTGTGTGTATGTAAGAGAAAGGG + Intronic
951785001 3:26408173-26408195 GTGTGTGTGTGTATATACATGGG + Intergenic
951856945 3:27208023-27208045 TTGTGTGTATGCATGTATTGTGG + Intronic
951884909 3:27514750-27514772 ATGTACGTATGTATGTAAAAAGG - Intergenic
952234558 3:31465330-31465352 ATGTGTCTAGATATGTAAATAGG - Intergenic
952492262 3:33884037-33884059 TTGTGTGTATGTGTGGGAAGGGG + Intergenic
952608951 3:35183596-35183618 TAGTGTGTAGGTTTGTAAGTTGG + Intergenic
952635572 3:35525410-35525432 ATGTGTGTATGTGTATACATGGG + Intergenic
952648381 3:35690786-35690808 TTGTGTGTATACTTGTAAAAAGG + Intronic
952841298 3:37648123-37648145 TTGTTGGTAGGAATGTAAATTGG - Intronic
952854637 3:37759305-37759327 GTGTCTGTGTGTATTTAAATTGG - Intronic
953229455 3:41051724-41051746 TAGTGTGTATGTGTGTGTATTGG - Intergenic
953401280 3:42620616-42620638 TTGTTTGTATGAATGTTAAAAGG + Intronic
953630637 3:44613605-44613627 TTGAGTGTATTTTTGTATATGGG - Intronic
953668709 3:44944865-44944887 TTGTTTTTATATATGTAAAATGG - Intronic
953727417 3:45412393-45412415 TTGTATGTATGTATTTGAGTGGG + Intronic
953749277 3:45596780-45596802 GTGTGTGTCTGTGTGTAGATGGG + Intronic
954381689 3:50222211-50222233 TTGTGTGTATGTGTATGCATGGG - Intergenic
954662911 3:52235535-52235557 GTGTGTGTGTGTGTGTGAATGGG - Intronic
954688032 3:52381105-52381127 GTGTGTGTGTGTATGTGACTGGG + Intronic
954957406 3:54533813-54533835 GTGTGTGTGTGTGTGTTAATAGG + Intronic
954982261 3:54756968-54756990 TTGTTTTAATGTATGTAAAATGG - Intronic
955111515 3:55955274-55955296 GTGTGTGTGTGTGTGTAAGTGGG + Intronic
955358958 3:58256218-58256240 TTGTGATTATGTATGTATGTAGG - Intronic
955563450 3:60218856-60218878 ATGTATGTATGTATGTATGTAGG - Intronic
955603294 3:60671344-60671366 GTGTGTGTATGTGTGTATTTTGG - Intronic
955618126 3:60830815-60830837 TTGTGTGTGTGTGTGTGAATTGG - Intronic
955619840 3:60850995-60851017 CTTTGTGTATGTGTGTATATGGG - Intronic
956112191 3:65880923-65880945 GTGTGTGTGTGTATGTAACAGGG + Intronic
956149923 3:66230433-66230455 GTGTGTGCATGTATGTATGTAGG + Intronic
956226156 3:66961515-66961537 TTGTCTGGATATATGTAGATAGG - Intergenic
956374674 3:68601602-68601624 GTGGTTGTAAGTATGTAAATTGG + Intergenic
956508534 3:69969296-69969318 GTGTGTGTCTGTGTGTAAGTGGG - Intergenic
956571477 3:70701367-70701389 GTGTGTGTATGTATGTGTATGGG + Intergenic
957175702 3:76805488-76805510 GTGTGTGTATATATATATATGGG - Intronic
957264163 3:77939803-77939825 GTGTGTGTGTGTATCTGAATAGG - Intergenic
957274601 3:78074592-78074614 TGATGTGTATTTATGTAATTGGG - Intergenic
957356818 3:79099768-79099790 TTGTTTGTATATATGTCAACTGG + Intronic
957614661 3:82510977-82510999 GTGTGTGTATGTGTATAAAAAGG - Intergenic
957647351 3:82949115-82949137 ATGTGTGTATACTTGTAAATTGG + Intergenic
957715012 3:83916922-83916944 GTGTGTGTATGTGTGTGTATAGG + Intergenic
957741426 3:84275050-84275072 GAGTGTGTGTGTATGTAAAGGGG + Intergenic
957775107 3:84748860-84748882 GTGTATGTATGTATGTATTTGGG - Intergenic
957791399 3:84945423-84945445 TTGTGTTTCTGTCTTTAAATGGG - Intergenic
957837772 3:85620359-85620381 TTGTGTGTATGTGTGTTTATTGG - Intronic
957936692 3:86953240-86953262 GTATGTGTATATATGTAGATTGG - Intronic
958032541 3:88130250-88130272 GTGTGTGTATGTGTGTATATGGG - Intronic
958455175 3:94322175-94322197 TTTTGTGTGTGTATGTAAGGAGG + Intergenic
958491025 3:94773571-94773593 TTGTGTGTATTTAGGTAGGTTGG + Intergenic
958512936 3:95072514-95072536 ATATGTGTATGTTTGTATATTGG + Intergenic
958617057 3:96507809-96507831 ATGTGTATGTGTATGTAAAGGGG + Intergenic
958800319 3:98747833-98747855 TTGTGTGTATATATAAAAAGGGG + Intronic
959139761 3:102471551-102471573 TTGTGTGTGTGTATGTGTGTAGG - Intronic
959190976 3:103111004-103111026 GTGTGTGTGTGTAAGTATATGGG + Intergenic
959455783 3:106559651-106559673 TGGCCTGTATGTATGTGAATAGG - Intergenic
959478083 3:106836885-106836907 TTGTTTGTATATATGTATATGGG - Intergenic
959487637 3:106945768-106945790 GTGTGTGTGTGTATGTGTATAGG - Intergenic
959500626 3:107102364-107102386 GTGTGTGTATGTGTTTAGATAGG - Intergenic
959545391 3:107590227-107590249 TTATATGTATTTATGTATATAGG + Intronic
959902505 3:111676006-111676028 CTGTATGTATGTATGTATACAGG + Intronic
960050466 3:113234351-113234373 GTGTGTGTATGTGTGCACATGGG + Intronic
960073275 3:113455721-113455743 TTGTGAATATGTATTTGAATTGG - Intronic
960179402 3:114557368-114557390 TTGGTTGTATTTTTGTAAATGGG - Intronic
960226055 3:115169729-115169751 TTGTGTGTATTTATGAATGTGGG + Intergenic
960453414 3:117839417-117839439 ATGTGTGTGTGTATATATATGGG - Intergenic
961022380 3:123519223-123519245 TTGTGTGTATGCATGCTAAGGGG - Intronic
961222037 3:125208741-125208763 GTGTGTGTGTGTGTGTAGATTGG - Intronic
962328422 3:134455629-134455651 ATATGTGTATGTGTGTATATAGG + Intergenic
962445562 3:135460883-135460905 ATGTGTGTGTGTGTGTAAATGGG + Intergenic
962616615 3:137133046-137133068 CTGTGTGTTTATATGTAAAATGG + Intergenic
962670382 3:137699988-137700010 GTGTGTGTGTGTGTGTAGATAGG - Intergenic
962723659 3:138200454-138200476 TTTTGTGTTTCTATGTAAAATGG + Intronic
962735123 3:138318781-138318803 TTGGATGAATGTATGGAAATGGG - Intronic
963436771 3:145279480-145279502 TGGTAGGTACGTATGTAAATTGG - Intergenic
963567698 3:146949993-146950015 TTTTTTGTAGCTATGTAAATGGG + Intergenic
963595955 3:147325168-147325190 ATGTGTGTATGTATGTGTGTGGG + Intergenic
963622740 3:147632854-147632876 GTGTGTGTGTGTATGTATATAGG + Intergenic
963892039 3:150646835-150646857 TTGTGTGCATATATAAAAATTGG + Intergenic
963962861 3:151329014-151329036 TTGTTTGTATATATGTTTATTGG - Intronic
964046166 3:152330033-152330055 GTGTGTGTATGTGTGTTTATTGG + Intronic
964091166 3:152877781-152877803 TTGTGTGTGTGTGTGTAATATGG + Intergenic
964829643 3:160869748-160869770 ATATTTGTAGGTATGTAAATTGG + Intronic
965172548 3:165285341-165285363 ATGTGTGTGTGTATGCAACTAGG - Intergenic
965348891 3:167588529-167588551 TTGTTGGTAGGAATGTAAATTGG - Intronic
965409819 3:168316715-168316737 ATGTGTGTATGAATATAAATGGG - Intergenic
965652931 3:170952701-170952723 GTGTGTGTATGTGTGTATAGAGG + Intergenic
965894842 3:173562976-173562998 TTGTGTGTATGTGTGTGGGTAGG - Intronic
965978035 3:174649710-174649732 CTGTGTGTATGTATGTATAAAGG - Intronic
966449910 3:180046831-180046853 ATGTGTGTATATATATACATAGG + Intergenic
966465079 3:180222507-180222529 GTGTGTGTGTGTGTTTAAATAGG - Intergenic
966656948 3:182369795-182369817 TTGTGTGTGTGCATGTGTATAGG + Intergenic
967158519 3:186714995-186715017 CTGTGTGTGTGTATGCATATGGG - Intergenic
967454171 3:189662937-189662959 TTGTTTCTATGTATATAAAGTGG + Intronic
967454414 3:189666847-189666869 TTGTGTGTATGTATGTAAATGGG + Intronic
967665065 3:192161499-192161521 GTGTGTGTGTGTGTGTAAATAGG - Intronic
967670352 3:192226521-192226543 ATGTGTGTATGTATATATGTGGG - Intronic
967889112 3:194352371-194352393 TGGGGTGTGTGTGTGTAAATGGG + Intergenic
967988008 3:195109965-195109987 TTGTGTGTATGTGTGTGGGTGGG + Intronic
968247423 3:197166473-197166495 GTGTGTGTATATATGTGCATAGG + Intronic
968430407 4:555148-555170 ATGTGTGGATGTGTGTAGATGGG - Intergenic
968430430 4:555278-555300 GTGTGTGCATGTGTGTAGATGGG - Intergenic
968430463 4:555456-555478 GTGTGTGGATGTGTGTAGATAGG - Intergenic
968430468 4:555500-555522 ATGTGTGCATGTGTGTAGATGGG - Intergenic
968430491 4:555630-555652 GTGTGTGGATGTGTGTAGATAGG - Intergenic
968788824 4:2645046-2645068 GTGTGTGTGTGTGTGTGAATGGG + Intronic
969061582 4:4439570-4439592 GTGTGTGTGTGTATATATATGGG - Intronic
969926270 4:10588607-10588629 TTGTGAAAATGAATGTAAATGGG - Intronic
969952964 4:10857528-10857550 GTATGTGTATGTGTGTAAATTGG - Intergenic
969966462 4:11001798-11001820 GTGTGTGTATATATATAAAGGGG - Intergenic
970049680 4:11899170-11899192 TTGTGTGTATGTTTGTGCAAAGG - Intergenic
970091474 4:12413157-12413179 TTGTGTGTATGTATGTGTTCAGG + Intergenic
970125485 4:12805078-12805100 TTGTTTGTAAGAATGTAAAATGG - Intergenic
970204736 4:13644610-13644632 ATGTGTGCATGTCTGTAAAAGGG + Intergenic
970677166 4:18464140-18464162 ATGTGTGTGTGTATATATATTGG + Intergenic
970678848 4:18484233-18484255 TTGTGTGTGTGCATGTGAAGGGG - Intergenic
970686739 4:18577118-18577140 GTGTGTGTGTGTGTGTAAAGGGG + Intergenic
970743897 4:19271659-19271681 TTGTGTGTAGGAATGTGAATAGG + Intergenic
970799912 4:19960657-19960679 AAGTGTGTGTGTATGTTAATTGG + Intergenic
971006267 4:22377084-22377106 TTGTATGTTTATATGTAAAAGGG + Intronic
971362398 4:25950225-25950247 TTGTTTGTTTGTCTGAAAATTGG + Intergenic
971534321 4:27729569-27729591 ATGTATGTATGTATGTATTTGGG - Intergenic
971724643 4:30294661-30294683 TTGTGTGTATGTGTGTATAAAGG - Intergenic
971761903 4:30776871-30776893 GTGTGTGTGTGTGTGTAAGTGGG + Intronic
971816828 4:31501721-31501743 GTGTGTGTGTGTGTGTAAAGGGG - Intergenic
971825651 4:31618686-31618708 ATGTGTGCATATATGTATATAGG - Intergenic
971883917 4:32417449-32417471 TTTTTAGTAGGTATGTAAATTGG - Intergenic
972046282 4:34668471-34668493 TTGTGTGTGAGTATGTATGTGGG + Intergenic
972171066 4:36346080-36346102 ATGTATTTATGTATGTGAATAGG - Intergenic
972238528 4:37162619-37162641 TTGTGTGTATGGGTATAGATGGG - Intergenic
972243385 4:37218593-37218615 ATGTATGTATGTGTGTTAATGGG + Intergenic
972243499 4:37219888-37219910 GTGTGTGTATATATATATATAGG + Intergenic
972314524 4:37913647-37913669 GTGTGTGTATATATATATATAGG + Intronic
972316660 4:37933192-37933214 TTGTGAGTATATATGCATATGGG - Intronic
972337992 4:38125492-38125514 TTGTGTGTGTGTATGTTGAATGG + Intronic
972406810 4:38754127-38754149 GTGTGTGCATGTATGTGTATGGG - Intergenic
972916678 4:43889982-43890004 ATGTATGTATGTATGTATGTAGG - Intergenic
973095149 4:46188204-46188226 GTGTGTGTATATATATATATGGG + Intergenic
973258748 4:48139576-48139598 TTGAGTGTATGTATGTATGTGGG - Intronic
974032252 4:56786644-56786666 TTGTGTGTGTGTGTGGAGATGGG - Intergenic
974117599 4:57599365-57599387 TTATGTATATGTATATAAATAGG - Intergenic
974215336 4:58839476-58839498 TTGTCTGTATGTTTGTATTTTGG - Intergenic
974225252 4:59033880-59033902 TTGTTTGTTTGTTTGTATATTGG - Intergenic
974292600 4:59952265-59952287 ATATGTGTATATATATAAATGGG + Intergenic
974308139 4:60169218-60169240 ATGTATGTATGTATATATATGGG - Intergenic
974376587 4:61085614-61085636 GTGTGTGTATGTGTGTGTATGGG + Intergenic
974485424 4:62498162-62498184 TTGTGTGTGTGTGTGTAATGTGG + Intergenic
974500479 4:62694079-62694101 GTGTGTGTGTGTATGTAGACTGG + Intergenic
974706875 4:65530384-65530406 TCGTATATATGTATGTAAACAGG + Intronic
974710239 4:65582767-65582789 TTGAGTAAATATATGTAAATTGG - Intronic
974872982 4:67666510-67666532 ATGTGTGTATATGTTTAAATAGG - Intronic
974920667 4:68235318-68235340 TTGTTTGTCTGTAGGTAAGTAGG + Intronic
975042033 4:69757579-69757601 TTGTGTGTGTGTGTGTAGATGGG - Intronic
975217951 4:71778982-71779004 TTTTGTGTGTGTGTATAAATAGG - Intronic
975244223 4:72099897-72099919 TTATGTATATGTGTGGAAATGGG - Intronic
975293021 4:72699474-72699496 GTGTGTGTGTGTATGTATGTTGG - Intergenic
975307022 4:72861535-72861557 TGGTGTGTATGTATTTATGTAGG + Intergenic
975400720 4:73935520-73935542 CTGTGTGTATATATGTATATAGG + Intergenic
975408252 4:74017164-74017186 TTGTGTGTGTGGATGTATATAGG + Intergenic
975428740 4:74262092-74262114 ATGTGTGAATCTATGTAAATAGG + Intronic
976019026 4:80597042-80597064 TTGTGTGCATATATGTATATTGG + Intronic
976107353 4:81633269-81633291 TTGTGTGTTTGAATGGACATGGG - Intronic
976496056 4:85731075-85731097 ATATGTGTATGTATGCAAAACGG + Intronic
976949226 4:90809144-90809166 GTGTGTGTGTGTGTGGAAATGGG - Intronic
977246726 4:94640100-94640122 CTGTGACTATGTAGGTAAATGGG - Intronic
977284538 4:95085997-95086019 GTGTGTGTGTGTGTGTAAAAAGG + Intronic
977381917 4:96286235-96286257 GTGTGTGTGTGTGTATAAATTGG - Intergenic
977540171 4:98308166-98308188 GTGTGTGTATGTATGTGTATGGG + Intronic
977661879 4:99597996-99598018 CTGTGTGTGTGTGTGTAACTTGG - Intronic
977670496 4:99689575-99689597 ATGTGTGTATGTGTGTACTTAGG + Intergenic
977826660 4:101540767-101540789 ATATGTGTATGTATGTGCATAGG - Intronic
978082318 4:104608689-104608711 TTTTTTGTATATATGTCAATAGG - Intergenic
978131961 4:105209620-105209642 TTGTGTGTATGTTTCTGAATGGG + Intronic
978177927 4:105756485-105756507 GTGTGTGTGTGTATGTGCATAGG - Intronic
978414091 4:108457434-108457456 TTGTTAGTATGAGTGTAAATTGG + Intergenic
978456927 4:108904623-108904645 TTGTGTGTGTGTATGTGGGTGGG + Intronic
979035762 4:115715016-115715038 TTGCATGTATGTTTGTACATTGG - Intergenic
979269485 4:118743342-118743364 GTGTGTGTATATATATATATAGG - Intronic
979442842 4:120772382-120772404 TTATGTTTATGACTGTAAATAGG - Intronic
979535420 4:121814425-121814447 TTGTGTGTGTGTATGTATGTGGG + Intronic
979535422 4:121814429-121814451 GTGTGTGTATGTATGTGGGTGGG + Intronic
979635048 4:122947534-122947556 TTATTTGTATGTAAGTAAACTGG - Intronic
979798218 4:124874070-124874092 TTCTTTGTAAATATGTAAATAGG - Intergenic
980319617 4:131253189-131253211 ATGTGTGTATATATGTGTATAGG - Intergenic
980661118 4:135859444-135859466 TTAGCTGTGTGTATGTAAATAGG - Intergenic
980681112 4:136161886-136161908 TTGTGTGTATGTGTGTATCTGGG + Intergenic
980732143 4:136837300-136837322 ATGTGTGTGTGTATGTTAAACGG - Intergenic
980737809 4:136913735-136913757 GTGTGTGTCTGTGTGTATATAGG + Intergenic
980975769 4:139608995-139609017 GTGTGTGTTTGTGTGTAAAGTGG + Intergenic
981053530 4:140335857-140335879 TTGTGTGTGTGCATGCTAATCGG - Intronic
981469206 4:145110763-145110785 TTTTGTGTATATATTTCAATAGG + Intronic
981605524 4:146536363-146536385 GTGTGTGTGTGTATATATATGGG + Intergenic
981797115 4:148608200-148608222 ATGTATGTATATATGTATATAGG + Intergenic
981817413 4:148847006-148847028 GTGTGTGTGTGTATGTATCTTGG + Intergenic
982759709 4:159266640-159266662 GTGTGTGTATGTGTGTGTATGGG + Intronic
982984156 4:162183545-162183567 GTGTGTGTGTGTGTGTAAATAGG - Intergenic
983006572 4:162491918-162491940 TTGTTGGTGTGAATGTAAATTGG + Intergenic
983310666 4:166057120-166057142 ATGTGTGTATGTATGTGAAATGG - Intronic
983400412 4:167257505-167257527 TGATGTTTATGTATTTAAATTGG + Intergenic
983432379 4:167667623-167667645 ATGTGTATGTGTATGTACATAGG - Intergenic
983562846 4:169118206-169118228 GTGTGTGCATGCATGTACATGGG - Intronic
983922417 4:173360130-173360152 GTGTGTGTGTGTGTGTAAAAGGG + Intergenic
984043408 4:174767117-174767139 GTGTGTGTGTGTGTGTAAAATGG - Intronic
984148667 4:176097714-176097736 GTGTGTGTGTGTGTGTAAGTGGG - Intronic
984231054 4:177099553-177099575 ATGTGTGTATGTATATAAGTAGG - Intergenic
984330948 4:178317660-178317682 TAGTGTGTATGTCTGTATGTGGG + Intergenic
985066681 4:186129071-186129093 TTGTGTCCATGTATGTGTATGGG + Intronic
985166324 4:187098931-187098953 TTGGGTATATATATATAAATTGG + Intergenic
985637569 5:1045899-1045921 TTGTGTGGATGAGTGTGAATGGG + Intergenic
986447395 5:7833662-7833684 ATATGTGTATGCATGTATATAGG - Intronic
986590677 5:9366244-9366266 TTGTGGAAATGTATGCAAATTGG + Intronic
986926725 5:12763323-12763345 ATGTGTGTATGTGTATAAACAGG + Intergenic
987051612 5:14151402-14151424 GTGTGTGTATGTATGTATGTAGG + Intronic
987698015 5:21357081-21357103 GTGTGTGTGTGTGTGTACATGGG + Intergenic
987735399 5:21835272-21835294 ATGTGTGTGTGTATATATATAGG - Intronic
987760380 5:22154399-22154421 ATGTGTGTGTGTGTGTAAACTGG - Intronic
987770843 5:22302226-22302248 CTGTGTGTGTGTATGTAGAGCGG - Intronic
987781026 5:22435389-22435411 GTGTGTGTATATATATATATGGG - Intronic
987815410 5:22894819-22894841 GTGTGTGTGTGTATGTGATTTGG + Intergenic
987827206 5:23047536-23047558 TTGTGTGCATGCATGTGAAGAGG + Intergenic
987848023 5:23313299-23313321 GTGTGTGTGTGTGTGTACATGGG + Intergenic
987917668 5:24236432-24236454 GTATGTGTCTGTGTGTAAATGGG + Intergenic
987925112 5:24330843-24330865 CTGTATGTATGTATGTATGTAGG + Intergenic
988110261 5:26810180-26810202 GTGTGTGTGTGTGTGTAAATGGG - Intergenic
988291362 5:29292259-29292281 ATGTGTGTGTGTATGTAGATAGG - Intergenic
988433924 5:31151049-31151071 GTGTGTGTGTGTGTGTAAAAGGG - Intergenic
988668368 5:33354758-33354780 GTGTGTGTGTGTATGTATAGTGG - Intergenic
988700730 5:33671994-33672016 GTGTGTGTATGTGAGTATATGGG - Intronic
988700740 5:33672128-33672150 ATGTGTGTGTGTATGTATGTGGG - Intronic
988910905 5:35842141-35842163 ATGTGTGTGTGTATATATATAGG + Intergenic
989291697 5:39774673-39774695 TTGTGTTTAGGAATGTAAAATGG + Intergenic
989765588 5:45078910-45078932 CTGTGTGAATTTATGCAAATTGG + Intergenic
989787967 5:45354005-45354027 ATGTGTGTATAAATATAAATAGG - Intronic
990272229 5:54155675-54155697 GTGTGTGTGTGTGTGTGAATGGG - Intronic
990814004 5:59762696-59762718 ATATGTGTATATATGTATATAGG + Intronic
990974940 5:61551675-61551697 ATGTCTGTATGTCTGTATATAGG + Intergenic
990998355 5:61756513-61756535 GTGTGTGTGTGTGTGTGAATAGG + Intergenic
991246653 5:64515701-64515723 GTGTGTGTGTGTATGCATATAGG - Intronic
991742425 5:69695297-69695319 GTGTGTGTGTGTGTGTACATGGG - Intergenic
991755269 5:69859911-69859933 GTGTGTGTGTGTGTGTACATGGG + Intergenic
991793999 5:70275037-70275059 GTGTGTGTGTGTGTGTACATGGG - Intergenic
991821815 5:70570600-70570622 GTGTGTGTGTGTGTGTACATGGG - Intergenic
991834596 5:70735059-70735081 GTGTGTGTGTGTGTGTACATGGG + Intergenic
991886376 5:71274569-71274591 GTGTGTGTGTGTGTGTACATGGG - Intergenic
991895129 5:71387813-71387835 GTGTGTGTGTGTGTGTAAACTGG - Intergenic
992343624 5:75852338-75852360 TTTTGTGTATTTATTTAACTTGG - Intergenic
992521594 5:77557053-77557075 TTTTGTTTATGTGTGTAAAAGGG - Intronic
993042170 5:82826694-82826716 TTGCATGACTGTATGTAAATGGG - Intergenic
993095848 5:83476693-83476715 GTGTGTGTGTGTATGTATACAGG + Intronic
993295931 5:86140480-86140502 TTGTGTGTTTGCATTTAAAGTGG - Intergenic
993348182 5:86812066-86812088 GTGTGTGTACATATGTATATAGG - Intergenic
993378838 5:87182450-87182472 GTGTGTGTGTGTGTGTAAAATGG - Intergenic
993612078 5:90066753-90066775 GTGTGTGTATGTGTGTGCATGGG - Intergenic
993935517 5:93996200-93996222 ATGTGTGTATGTATATATTTAGG - Intronic
993940099 5:94047933-94047955 TTTTGTGTTTGTTTTTAAATGGG - Intronic
994067162 5:95555934-95555956 TTGTGTGTATGTGTGTGTGTTGG + Intronic
994172438 5:96672269-96672291 CTGTGTGTGTGTATGCAAATAGG + Intronic
994261205 5:97660989-97661011 GTGTGTGTGTGTGTGTAGATGGG + Intergenic
994291804 5:98035321-98035343 ATATGTATATGTATATAAATGGG + Intergenic
994407968 5:99369535-99369557 GTGTGTGTATTTAGGTAAAAGGG + Intergenic
994490868 5:100441691-100441713 GTGTGTATATGTGTGTATATAGG + Intergenic
994548051 5:101193964-101193986 GTGTGTATATGTATGTAGGTAGG - Intergenic
994561541 5:101379971-101379993 TTGTGTGTGGCTATGTAAATGGG + Intergenic
994674893 5:102808386-102808408 GTGTGTGTGTGTATGTGCATAGG + Intronic
994762332 5:103870898-103870920 GTGTGTGTATGTGTGTGTATAGG - Intergenic
994936943 5:106266550-106266572 GTGTGTGTATGTTTGTATAGGGG + Intergenic
994960278 5:106592912-106592934 TTGTATGTATTTATATAAAAAGG - Intergenic
995024634 5:107405369-107405391 TGGAATGTCTGTATGTAAATGGG - Intronic
995082188 5:108065152-108065174 GTATGTGTGTGTATGTATATGGG + Intronic
995478157 5:112568722-112568744 TTGTGTGTGTGTATGTCTAAAGG + Intergenic
995520991 5:113005154-113005176 GTGTGTGTGTGTGTGTAAACTGG + Intronic
995783285 5:115800851-115800873 ATGTGTGTATGTATTGATATAGG - Intergenic
995906000 5:117124037-117124059 TTGTGTCTATATATTTAAAGTGG + Intergenic
996230298 5:121055680-121055702 GTGTGTGTGTGTGTGTAAAGGGG + Intergenic
996384610 5:122898059-122898081 TTGTGTGCATGTATGTGTGTCGG + Intronic
996430469 5:123370708-123370730 ATGTGTGTATGTATGTATATAGG - Intronic
996604445 5:125304692-125304714 GTGTGTGTATATATATATATAGG - Intergenic
996643652 5:125789678-125789700 ATGTGTTTATGTGTGTATATAGG - Intergenic
996668828 5:126092456-126092478 TTGTGTGTATGTGTGTGTAATGG + Intergenic
996928178 5:128854058-128854080 TTGTAAGTATGTATCTCAATAGG + Intronic
997451151 5:133984454-133984476 GTGTGTGTGTGTGTGTAGATGGG + Intronic
998042068 5:138957077-138957099 TTGTGTGTGTGTCTGTCAGTAGG - Intronic
998134959 5:139669740-139669762 TTGTGTGTGTGTGTGTAGCTTGG - Intronic
998314127 5:141164771-141164793 TTGTGTGTGTGTATTGAGATGGG - Intergenic
998658231 5:144205819-144205841 TTGTATTTATGTATGTATGTAGG - Exonic
998906940 5:146915441-146915463 GTGTGTGTGTGTGTGTACATAGG - Intronic
998945558 5:147336161-147336183 GAGTGTGTATGTATATATATGGG - Intronic
998999892 5:147908937-147908959 GTGTGTGTATGTATGTGTTTTGG - Intergenic
999042832 5:148434595-148434617 TTGTGTATGTGTATGTATACAGG + Intronic
999269629 5:150289291-150289313 TTGTGTGTATGTGTGTGCACTGG + Intronic
999336944 5:150728096-150728118 TTGTGTGTTTATATTTTAATAGG - Intronic
999521468 5:152355042-152355064 GTGTGTGTGTGTGTGTGAATAGG + Intergenic
999530802 5:152461599-152461621 GTGTGTGTGTGTATGTATATAGG + Intergenic
999617739 5:153442931-153442953 TTGTGTGTATGTTTGGGAACTGG - Intergenic
999623953 5:153500600-153500622 GTGTGTGTGTGTATGTAAGAGGG - Intronic
999647436 5:153732323-153732345 TTGTTGGTGTGAATGTAAATTGG - Intronic
999732820 5:154488123-154488145 GTGTGTGTGTGTGTGTAAAGTGG + Intergenic
999784279 5:154877544-154877566 TTGTGTGTATGAGTGCATATAGG + Intergenic
999875050 5:155795758-155795780 TTGTGTCTGTGTATTTAAAGTGG - Intergenic
1000378436 5:160606290-160606312 TTGTGTGTTTATTTCTAAATAGG - Intronic
1000438181 5:161239170-161239192 GTGTGTGTATGTATGTATGTGGG - Intergenic
1000460745 5:161514589-161514611 GTGTGTATGTGTGTGTAAATTGG + Intronic
1000568955 5:162886507-162886529 GTGTATATATGTATGTATATAGG + Intergenic
1000603898 5:163307620-163307642 GTGTGTGTGTGTGTGTAGATAGG + Intergenic
1000727707 5:164792374-164792396 GTGTGTGTGTGTATATATATAGG + Intergenic
1000823882 5:166019723-166019745 ATGTTCGTGTGTATGTAAATGGG + Intergenic
1000836307 5:166158768-166158790 GTGTGTGTATATATGTAATGGGG + Intergenic
1001067443 5:168548029-168548051 GTGTGTGTGTGTGTGTAAATGGG - Intergenic
1001184864 5:169560546-169560568 TGTTGTATATGTATGTATATTGG + Intergenic
1001346566 5:170905598-170905620 CTGTGTGTTTGTGTGTACATAGG + Intronic
1001896649 5:175388320-175388342 TTTTATTTATGTATGTAAAAAGG + Intergenic
1002963475 6:1939566-1939588 GTGTGTATATATATGTATATAGG - Intronic
1003288128 6:4752846-4752868 GTGTGTGTGTGTTTGTAGATAGG + Intronic
1003335650 6:5169611-5169633 TGGTGTATATGTATGAAAATAGG - Intronic
1003350268 6:5310564-5310586 TTGTGTGTGTGCGTGTGAATTGG + Intronic
1003791177 6:9549598-9549620 GTGTGTGTGTGTATATATATAGG - Intergenic
1004165219 6:13250994-13251016 GTGTGTGTGTGTGTGTAAAATGG - Intronic
1004373370 6:15071883-15071905 GTGTGTGTGTGTATGAAAAAAGG - Intergenic
1004648607 6:17587027-17587049 GTGTGTATATGTATATATATGGG - Intergenic
1004648619 6:17587215-17587237 GTGTGTGTGTGTGTGTATATGGG - Intergenic
1004830328 6:19470247-19470269 GTGTGTGTGTGTGTGTGAATGGG - Intergenic
1004883061 6:20027734-20027756 GTGTGTGTGTGTATGTGTATAGG - Intergenic
1004922239 6:20386550-20386572 ATGTATGTATGTATGTATTTAGG + Intergenic
1005107991 6:22246129-22246151 TTGTTAGTATGAATGTAAAATGG - Intergenic
1005160432 6:22854903-22854925 TTTTGTGTGTGTGTGAAAATTGG - Intergenic
1005286523 6:24333446-24333468 TTGCGTGTGTGTGTGTGAATTGG - Intronic
1005364136 6:25060501-25060523 TTGTGTGTGTGTGTGGAAAGGGG + Intergenic
1005552834 6:26941297-26941319 GTGTGTGTGTGTGTGTACATGGG - Intergenic
1005573702 6:27172158-27172180 GTGTGTGTGTGTATGTATATAGG - Intergenic
1005725667 6:28645307-28645329 CTGTGTGTATACATGTATATAGG + Intergenic
1005952313 6:30641102-30641124 GTGTGTGTATGTGTGTATATGGG - Intronic
1006118674 6:31790853-31790875 ACGTGTATATGTAAGTAAATAGG + Intronic
1006308574 6:33240763-33240785 CTGTGTGTGTGTGTGTAAACTGG + Intergenic
1006721696 6:36157970-36157992 TTGTGTGTGTGTGTGTATACAGG - Intergenic
1006865220 6:37204322-37204344 CTGTGTGTATGTTTGTAATCTGG - Intergenic
1007023305 6:38544427-38544449 GTGTGTATATGTATGTATATGGG + Intronic
1007057426 6:38901701-38901723 TTGTGTGTTTGTTTATAAATTGG - Intronic
1007242470 6:40437000-40437022 GTGTGTGTGTGTATGTGTATGGG + Intronic
1007668668 6:43533207-43533229 GTGTGTGTGTGTGTGTAGATAGG - Intronic
1007809265 6:44474698-44474720 GTGTGTGTGTGTGTGTAAAAAGG + Intergenic
1007940527 6:45776440-45776462 ATGTGTGTATGTGTGTAATATGG - Intergenic
1008020125 6:46566887-46566909 GTGTGTGTATGTGTATATATGGG - Intronic
1008181574 6:48337103-48337125 GTGTATGTATGTATGTAATAAGG - Intergenic
1008255954 6:49299761-49299783 GTGTGTGTATGTGTGTATTTGGG - Intergenic
1008297828 6:49799650-49799672 TTATGTGTGTGTATTGAAATTGG - Intergenic
1008323785 6:50151289-50151311 TTGTTTGTATGTATGAGAGTTGG - Intergenic
1008348100 6:50454374-50454396 TTTTGTATATGTATATAAAAGGG - Intergenic
1008371093 6:50731439-50731461 GTGTGTGTGTGTATGAAAGTGGG - Intronic
1008585732 6:52947269-52947291 GTGTGTGTGTGTGTGTAGATGGG - Intergenic
1008771289 6:54981894-54981916 TTGTGTGTATGTGTGATTATAGG + Intergenic
1009730085 6:67590980-67591002 GTGTGTGTGTGTGTGTAAATTGG + Intergenic
1010047041 6:71457236-71457258 TTATGTCTATGAATGTACATTGG + Intergenic
1010106395 6:72174172-72174194 CTAAGTGTATGTATGTAAAAGGG - Intronic
1010307437 6:74341671-74341693 GTGTGTGTCTGTATGTGAAATGG + Intergenic
1010605490 6:77885099-77885121 TTTTGTGTGGGTATTTAAATAGG + Intronic
1010674533 6:78726051-78726073 GTGTGTGTGTGTGTGTAAATTGG + Intergenic
1010763850 6:79756024-79756046 GTGTGTGTGTGTGTGGAAATGGG + Intergenic
1010828418 6:80501062-80501084 ATCTGTGTATATATGTATATAGG - Intergenic
1010873907 6:81077436-81077458 ATGTGTGTATGCATATATATAGG - Intergenic
1010977029 6:82326784-82326806 GTGTGTGTGTGTGTGTCAATGGG + Intergenic
1011100682 6:83717766-83717788 ATGTGTGTATATATGTGCATAGG - Intergenic
1011107183 6:83795501-83795523 GTGTGTGTGTGTGTGCAAATAGG + Intergenic
1011109055 6:83816114-83816136 GTGAGTGTGTGTATGTAAAGGGG + Intergenic
1011514666 6:88140434-88140456 TGGGCTGAATGTATGTAAATAGG - Exonic
1011837751 6:91455009-91455031 TTGTGTGTATGTTTGCATGTGGG + Intergenic
1011877639 6:91980806-91980828 TTGTGTGTCTGTATGGGAAAGGG - Intergenic
1011909566 6:92419822-92419844 ATGTGTGTATATATATATATTGG + Intergenic
1012009535 6:93764858-93764880 TAGTGTGTATAAATGTATATAGG - Intergenic
1012640936 6:101612742-101612764 GTGTGTGTGTGTAGGTACATAGG + Intronic
1012818763 6:104058249-104058271 GTGTGTGTATGTGTGTAGATGGG - Intergenic
1012876035 6:104727105-104727127 GTGTGTATATATATGTATATGGG + Intergenic
1012975259 6:105774043-105774065 GTGTGTGTATGTATGTGTGTAGG - Intergenic
1013501108 6:110752737-110752759 TTTTGTGTATGTATGGAGACAGG + Intronic
1013508356 6:110821289-110821311 CAGTGTGTTTATATGTAAATGGG - Intronic
1013534862 6:111054666-111054688 GTGTGTGTGTATATGTATATTGG - Intergenic
1013799260 6:113922105-113922127 GTGTGTGTGTGTTTGTAAATAGG + Intergenic
1013895375 6:115081698-115081720 GTGTGTGTTTGTATGTATGTAGG + Intergenic
1013995145 6:116299598-116299620 GTGTGTATATGTATGTATGTAGG + Intronic
1013999587 6:116349220-116349242 AGGTGTGTATGTATGTATATGGG - Intronic
1014037492 6:116784263-116784285 GTGTGTGTATGTATATATAAAGG + Intergenic
1014175797 6:118330045-118330067 ATGTGTGTATATATATATATAGG + Intergenic
1014244848 6:119057142-119057164 TAGTGTGTATGTGTGTATTTGGG - Intronic
1014322253 6:119944598-119944620 GTGTGTGTGTGTATGTGTATAGG - Intergenic
1014415244 6:121176022-121176044 TTGTATGTATGTGTGTTTATTGG - Intronic
1014463333 6:121725656-121725678 TTCTTTGTATGTGTGTGAATGGG - Intergenic
1014598502 6:123376880-123376902 TTGTGTGTGTGTGTGTGTATGGG - Intronic
1014638172 6:123874884-123874906 ATGTATGTATGTATGTATGTAGG - Intronic
1014975149 6:127871284-127871306 ATGTGTATGTGTATGTATATAGG - Intronic
1014985628 6:128004029-128004051 TTGTATGCTTGTATGTAAAGAGG - Intronic
1015216546 6:130756517-130756539 TTTTATGTATGTATGTAGCTGGG - Intergenic
1015337515 6:132057363-132057385 GTGTGTGTGTGTATGTAAAGGGG + Intergenic
1015476046 6:133659691-133659713 TTGTGTGTCTGTGTGTCTATGGG - Intergenic
1015836656 6:137427278-137427300 GTGTGTGTGTGTACATAAATTGG - Intergenic
1015980632 6:138834888-138834910 GTGTGTGTGTGTGTGTAAACGGG - Intronic
1016227223 6:141753104-141753126 GTGTGTGTGTGCATGTAATTTGG - Intergenic
1016283406 6:142445989-142446011 TTGTGTTTATATATGTCAATTGG + Exonic
1016587141 6:145701894-145701916 TTGTGTGTGTGTGTGGCAATTGG - Intronic
1016605475 6:145918341-145918363 TTGTGTTTTAGAATGTAAATAGG - Intronic
1016679989 6:146818074-146818096 TTGTTTCTATGTATGTACTTTGG - Intergenic
1016704108 6:147087097-147087119 ATGTGTGTGTGTATATATATGGG + Intergenic
1016771544 6:147857635-147857657 ATGTATGTATGCCTGTAAATGGG + Intergenic
1017148741 6:151259041-151259063 ATGTGTGTATATATATATATTGG + Intronic
1017324465 6:153130463-153130485 GTATGTGTATGTATGTATAGGGG - Intronic
1017404733 6:154107053-154107075 TTGTATGTTTATATGTAAAAGGG - Intronic
1017430574 6:154366735-154366757 GTGTGTGTATTTATATATATAGG - Intronic
1017714928 6:157202780-157202802 GTGTGTGTGTGTATTTATATGGG + Intronic
1017966233 6:159269407-159269429 ATGTATGTATGTATGTATGTAGG + Intronic
1018030788 6:159839764-159839786 TTGTGTGTATGTGTGTGTGTTGG + Intergenic
1018108195 6:160509052-160509074 GTGTGTGTGTGTGTGTAGATGGG - Intergenic
1018204730 6:161426638-161426660 GTGTGTGTGTGTGTGTAAAGGGG - Intronic
1018609723 6:165636296-165636318 TTGTGTGTGTGTGTGTGTATGGG - Intronic
1018788180 6:167125085-167125107 GTGTGTGTATGTATGTGTCTAGG - Intronic
1018941552 6:168311499-168311521 TTGTGTGTGTGTATGTGTGTGGG - Intronic
1018949927 6:168372394-168372416 GTGTGTGTGTGCATGTACATGGG - Intergenic
1018949937 6:168372465-168372487 TTGTGTGTGTGCGTGTACATGGG - Intergenic
1019109193 6:169696411-169696433 TTGTGTGCATGTGTGTATACAGG - Intronic
1020466951 7:8490948-8490970 CTGTGTCTATGAATGTAAATAGG + Intronic
1020645070 7:10805313-10805335 TTATGTGTGTGACTGTAAATGGG - Intergenic
1020879701 7:13744420-13744442 ATGTGTGCATGTATGTATACAGG + Intergenic
1020994741 7:15249321-15249343 TTGTGTGTAAGTGTGGAAAGAGG + Intronic
1021834910 7:24660533-24660555 GTGTGTGTGTGTTTGTCAATAGG - Intronic
1021946110 7:25729079-25729101 GTGTGTGTGTGTGTGTAAAAGGG + Intergenic
1022158255 7:27681929-27681951 GTGTGTGTGTGTGTGTAAAATGG + Intergenic
1022202961 7:28135837-28135859 CTGTTTGTATCTATGTAACTAGG + Intronic
1022211282 7:28212452-28212474 TTGTGTGTGTGTGTGGAGATGGG - Intergenic
1022366422 7:29723856-29723878 GTGTGTGTGTGTATGAAACTTGG - Intergenic
1022366426 7:29723903-29723925 GTGTGTGTGTGTATGAAACTTGG - Intergenic
1022380610 7:29856035-29856057 ATGTATGTATATATGTAGATAGG + Intronic
1022818656 7:33937548-33937570 TTGTGTGTATGTGTGTATCTGGG + Intronic
1022866501 7:34427232-34427254 ATATATGTATGTATGTATATGGG + Intergenic
1022931315 7:35118160-35118182 GTGTGTGTGTGTATGAAACTTGG + Intergenic
1023186073 7:37534354-37534376 TTTTGTGTATGTCTCTAGATAGG + Intergenic
1023709022 7:42971933-42971955 TTGTGTGTATGACAGTAAACAGG + Intergenic
1023761416 7:43468172-43468194 TTGTGTGTGTGTATGTGTAGGGG - Intronic
1024401615 7:48929967-48929989 ATGTATGTATGTATGTATGTAGG + Intergenic
1024401616 7:48929971-48929993 ATGTATGTATGTATGTAGGTAGG + Intergenic
1024529888 7:50382926-50382948 TTCTGTGTGTGTATGTGCATGGG - Intronic
1024578564 7:50783465-50783487 TGGTGTGTATGTATGTGAGTGGG - Intronic
1024752623 7:52486254-52486276 CTGTGTATATGTATGTACATAGG - Intergenic
1024759559 7:52579143-52579165 ATGAGTGTATGTATGTATTTAGG + Intergenic
1024846427 7:53648799-53648821 TGGTGTGTAAGAATGTAAAATGG - Intergenic
1024878784 7:54060435-54060457 ATGTGTGTATGTATGGAAAGGGG - Intergenic
1024883535 7:54115907-54115929 GTGTGTGTATGTCTGGAAATTGG - Intergenic
1024954140 7:54898402-54898424 TTGTGTTTATGTATGAAGGTAGG - Intergenic
1024970773 7:55067932-55067954 ACGTGTGTATGCATGTATATGGG + Intronic
1024971583 7:55076548-55076570 TGGTGTGTATGTGTAAAAATAGG - Intronic
1025736041 7:64147587-64147609 GTGTGTGTGTGTATATATATTGG - Intronic
1025865806 7:65379545-65379567 TAGTGAGTATGTTTGTAAGTGGG - Intronic
1025972484 7:66340631-66340653 TTTTTTGTAGCTATGTAAATGGG - Intronic
1026037318 7:66839207-66839229 ATATGTGTATGTATATATATGGG + Intergenic
1026134606 7:67648593-67648615 GTGTGTGTGTGTGTGTAGATGGG - Intergenic
1026312347 7:69197382-69197404 TTGTGTGTGTGTGTGGAGATGGG - Intergenic
1026500043 7:70936329-70936351 GTGTGTGTATGTGTGTATGTGGG + Intergenic
1026559685 7:71438141-71438163 ATGTATGTATGTATGTATATGGG + Intronic
1026607549 7:71828726-71828748 GTGTGTGTGTGTGTGTAATTTGG + Intronic
1026678500 7:72447901-72447923 GTGTGTGTATGTGTGTACATGGG - Intergenic
1026679569 7:72455349-72455371 GTGTGTGTGTGTGTGTACATAGG + Intergenic
1026975644 7:74496254-74496276 ATGTGTGTATGCATGTGAGTGGG + Intronic
1027331164 7:77095263-77095285 GTGTGTGTGTGTGTGTATATAGG + Intergenic
1027343467 7:77234160-77234182 GTGTGTGTTTGTATGTATATGGG - Intronic
1027537241 7:79418820-79418842 GTGTGTGTGTGTATGTGTATTGG - Intronic
1027920551 7:84388096-84388118 TTGTGTGTGTGTATTTATATAGG - Intronic
1027963040 7:84970987-84971009 GTGTGTGTATGTGTGTTCATAGG - Intergenic
1028004953 7:85553482-85553504 TTGTGTGCATCTGTGTAAATAGG - Intergenic
1028032019 7:85927898-85927920 TTGTTTGTTTTTATGAAAATAGG + Intergenic
1028188999 7:87823843-87823865 TGGTATGTATGTATGTATGTAGG - Intronic
1028338476 7:89687963-89687985 CTGTGTGTATGTATATCAAATGG + Intergenic
1028488465 7:91385350-91385372 GTGTGTGTATGTGTGTATGTTGG + Intergenic
1028727063 7:94100209-94100231 ATGTGAGTATGTAGGAAAATGGG + Intergenic
1029100235 7:98123690-98123712 GTGTGTGTATATATGAAAATTGG - Intronic
1029425226 7:100490346-100490368 GTGTGTGTTTGTATGTATGTTGG + Intronic
1029648341 7:101872671-101872693 TTGTGTGTGTATGTGTCAATAGG + Intronic
1029784609 7:102776095-102776117 TTGTGTGTGTGTGTGTGTATAGG - Intronic
1029827216 7:103210678-103210700 GTGTGTGTGTGTATGAAACTTGG + Intergenic
1029960349 7:104683738-104683760 TTGTTTTTATTTTTGTAAATTGG - Intronic
1029987899 7:104938467-104938489 GTGTGTGTGTGTGTATAAATAGG - Intergenic
1030036543 7:105412203-105412225 GTGTGTGTATATATATATATAGG + Intergenic
1030189847 7:106800111-106800133 GTGTGTGTTTGTGTGTAAAGTGG - Intergenic
1030476835 7:110045086-110045108 TTATATGTGTGTATGTGAATTGG - Intergenic
1030708582 7:112721796-112721818 GTGTGTGTATGTATGTATGCAGG - Intergenic
1030971810 7:116066609-116066631 TTGAGTGTTTGAATGTAACTGGG + Intronic
1031423278 7:121574767-121574789 ATGTGTGTGTGTATGTACATAGG + Intergenic
1031685405 7:124727536-124727558 TAGTGGGTATGTATGTATGTTGG - Intergenic
1031854299 7:126903555-126903577 GTGTGTGTGTGTATGTATTTAGG - Intronic
1031939400 7:127771639-127771661 CTATGTGTATGTATGTGTATAGG - Intronic
1032479413 7:132234618-132234640 GTGTGTGTGTGTATGTGTATTGG + Intronic
1032714900 7:134499629-134499651 GTGTGTGTGTGTGTGTACATAGG - Intergenic
1032773217 7:135080935-135080957 GTGTGTGTGTGTGTGTAATTAGG - Intronic
1032807903 7:135375952-135375974 GTGTGTGTATGTGTGTACAGGGG + Intronic
1032923138 7:136573410-136573432 GCGTGTATATATATGTAAATGGG + Intergenic
1033117376 7:138637529-138637551 GTGTGTGTGTGTATGTATGTAGG - Intronic
1033600845 7:142887622-142887644 GTGTGTGTATGTATGTCATGGGG + Intergenic
1033821505 7:145140241-145140263 TTGTGTGTATATGTGTATATAGG - Intergenic
1033840068 7:145361969-145361991 TTGTGTTTTTATATTTAAATCGG - Intergenic
1033869971 7:145740445-145740467 GTGTGTGTGTGTATATAAAATGG - Intergenic
1033981258 7:147169100-147169122 TTCTGTATATATCTGTAAATTGG + Intronic
1034091291 7:148366182-148366204 GTATGTGTATGCATGTATATAGG + Intronic
1034362913 7:150516808-150516830 TTGTGTGAATTTATATGAATGGG + Intronic
1034483385 7:151341045-151341067 ATATGTGTGTGTATGTAAAATGG - Intergenic
1034678885 7:152912841-152912863 TGGTGTGTGTGTATGTGAGTTGG + Intergenic
1035041659 7:155932503-155932525 ATGTGTGTATGTTTGTGCATGGG + Intergenic
1035551285 8:528847-528869 ATGTGTGTGTGTGTGTAAAGGGG + Intronic
1035894612 8:3385273-3385295 ATATATGTATGTATGTATATAGG + Intronic
1036063492 8:5352381-5352403 GTGTGTGTATGTATGTATAAAGG - Intergenic
1036382830 8:8249466-8249488 TTATGTGTTTGTATGTACTTGGG + Intergenic
1036542187 8:9726912-9726934 ATATGTGTGTGTATGTATATAGG + Intronic
1036784579 8:11677441-11677463 TGGTGTGTATGTATTTATTTAGG - Intronic
1037000277 8:13708626-13708648 GTTTGTGTATGTATGTATGTGGG + Intergenic
1037019242 8:13947794-13947816 TTCTATGTATGCATGTAAATAGG - Intergenic
1037209178 8:16364157-16364179 GTGTGTGTATGTGTGTAATATGG - Intronic
1037420967 8:18702302-18702324 TGGTGTGTGTTTATGTACATAGG + Intronic
1037440093 8:18906823-18906845 TTACGTGTATGTATATAATTAGG - Intronic
1037453662 8:19042072-19042094 TTGTGTGTATGTGTTTATATGGG + Intronic
1037611868 8:20482700-20482722 GTGTGTGTATGTGTGTGTATAGG + Intergenic
1037611895 8:20482976-20482998 TTGTGTGTATGTATGTGTAAGGG + Intergenic
1037647606 8:20807287-20807309 GTGTGTGTGTGTGTGTACATGGG - Intergenic
1038020231 8:23546491-23546513 GTGTGTGTATATATATATATAGG + Intronic
1038198642 8:25391235-25391257 GTGTGTGTGTGTGTGTAAATGGG + Intronic
1038680261 8:29660475-29660497 GTGTATGTATGTGTGTGAATAGG - Intergenic
1039005140 8:33027905-33027927 AATTGTGTATGTATGTAACTTGG - Intergenic
1039429977 8:37518380-37518402 TTGTGTGTCTGTGTGTGCATGGG + Intergenic
1039619427 8:38983004-38983026 TGGGGTTTATGTATGTAAAGTGG + Exonic
1039749917 8:40469025-40469047 TTGTTGGTAGGAATGTAAATTGG + Intergenic
1039778153 8:40757349-40757371 GTGTGTGTATGTGTGTACAGTGG - Intronic
1040394981 8:46989649-46989671 GTGTGTGTATATATATAAAGGGG + Intergenic
1040470520 8:47732411-47732433 ATGTGTGTATGTGTGTGCATTGG + Intronic
1040644638 8:49384031-49384053 ATGTGTGTATTTATGTGGATAGG + Intergenic
1040833150 8:51700575-51700597 GTGTGTATATGTGTGTATATGGG - Intronic
1041193493 8:55376923-55376945 TTGTGTGTGTGTATGGAGAGGGG - Intronic
1041299079 8:56392055-56392077 TTTTTTGTGTGTATTTAAATTGG - Intergenic
1041673936 8:60518703-60518725 GTGTGTGTGTGTGTGGAAATTGG + Intronic
1041819348 8:62012195-62012217 GTGTGTGTGTGTGTGTAGATGGG - Intergenic
1041877495 8:62707042-62707064 GTGTGTGTATGTATGTATGATGG - Intronic
1042014198 8:64289242-64289264 TTGTGTCTATGTATTTAAAGTGG + Intergenic
1042031204 8:64477903-64477925 CTGTGTGTATGTCTGTGCATAGG + Intergenic
1042504815 8:69548921-69548943 TTGTGTGTGTGTATGTGTGTGGG - Intronic
1042714234 8:71754890-71754912 GTGTGTGTATTAATGTATATTGG + Intergenic
1042931089 8:74014806-74014828 GTGTGTGTGTGTGTGTAAACTGG - Intronic
1043073624 8:75668137-75668159 GTGTGTGTGTGTATGTATATAGG + Intergenic
1043077969 8:75726517-75726539 GTGTGTGTATGTGTGTGTATGGG - Intergenic
1043196979 8:77307610-77307632 TTGTGAGTGTTGATGTAAATGGG + Intergenic
1043206115 8:77443396-77443418 ATGTATGTAGGTATGTAGATGGG - Intergenic
1043219235 8:77637554-77637576 ATGTGTATATATATGTATATGGG + Intergenic
1043238819 8:77904508-77904530 TTGTGTATATATATGTGCATGGG + Intergenic
1043316579 8:78929819-78929841 GTGTGTGTGTGTTTGGAAATGGG + Intergenic
1043494929 8:80790475-80790497 ATGTGTGTGTGTATTTACATAGG - Intronic
1043564592 8:81534088-81534110 GTGTGTGTATGTATGTGTGTGGG - Intergenic
1043653569 8:82631949-82631971 TTGTGTGGATCTATTTATATAGG - Intergenic
1043724140 8:83588304-83588326 GTGTGTGTGTGTCTGTACATGGG + Intergenic
1043805556 8:84668385-84668407 GTGTGTGTACGTATGTAACAGGG + Intronic
1043833680 8:85019991-85020013 GTGTGTGTGTGTATATATATAGG - Intergenic
1043842249 8:85121180-85121202 TTGTGTCTTTATATTTAAATGGG + Intronic
1043930876 8:86090322-86090344 CTGTGTGTATATATATAAAATGG - Intronic
1045169578 8:99649615-99649637 GTGTGTGTGTGTATGTAGAGGGG - Intronic
1045212716 8:100115102-100115124 ATATATGTATGTATGTAAAGGGG - Intronic
1045312700 8:101017109-101017131 GTGTGTGTGTGTTTGTAGATGGG + Intergenic
1045418254 8:101988336-101988358 GTGTGTGTATGTATTTACACAGG + Intronic
1045448997 8:102300652-102300674 TTGTGTGTAAAAATCTAAATTGG - Intronic
1045977213 8:108142993-108143015 GTGTGTGTGTGTGTGTAGATGGG - Intergenic
1046157808 8:110316429-110316451 TTGTGTGTGTGCATGTGGATGGG + Intergenic
1046167851 8:110462017-110462039 CTGTGTGTATGTATGTGTTTGGG + Intergenic
1046214270 8:111122475-111122497 GTGTGTGTGTGTGTGTAGATAGG - Intergenic
1046300642 8:112282295-112282317 TTTTATGTATATATGTAAAATGG - Intronic
1046373230 8:113339611-113339633 TTGGGTGAATGTATGCCAATTGG + Intronic
1046405465 8:113767157-113767179 GTGTGTGTGTGTGTGTAAGTGGG + Intergenic
1047245139 8:123136000-123136022 TTGTGTGTATATATGTGCATAGG - Intronic
1047718439 8:127617144-127617166 TTGTATGTATGTATGTATACAGG + Intergenic
1047776918 8:128079283-128079305 CTGTGTGTATGTAAATTAATAGG + Intergenic
1047848738 8:128833154-128833176 GTGTGTGTGTGTGTGTAAAGTGG + Intergenic
1047915234 8:129575826-129575848 GTGTGTGTATGTGTGTGACTGGG - Intergenic
1047930828 8:129726989-129727011 GTGTGTGTGTGTATGTGTATTGG - Intergenic
1048384966 8:133903742-133903764 TTGTGTGCATGTGTGCATATTGG - Intergenic
1048385776 8:133911346-133911368 GTGTGTGTGTGTATATATATAGG + Intergenic
1048400486 8:134063394-134063416 TTGTTGGTAGGAATGTAAATTGG + Intergenic
1048604086 8:135949432-135949454 ATGTATGTATGTTTGAAAATGGG - Intergenic
1048638341 8:136324743-136324765 TTGTGTGCTTGCATGTATATTGG - Intergenic
1048704427 8:137135642-137135664 GTGTGTGTGTGTATGCACATGGG + Intergenic
1049052114 8:140206714-140206736 GTGTATGTATGTATGTATTTGGG - Intronic
1049145628 8:141000082-141000104 GTGTGTGTGTGTGTGTGAATTGG - Intronic
1050115606 9:2260316-2260338 TTGTGTGCATGTATGTACACAGG + Intergenic
1050230672 9:3522620-3522642 GTGTGTGTTTGTGTTTAAATGGG - Intronic
1050360859 9:4829733-4829755 GTGTGTGTATGCATCTGAATTGG + Intronic
1050669340 9:7978692-7978714 TTATGTGTATATATGGAAGTAGG + Intergenic
1050772467 9:9219591-9219613 TTGTGTGTTTCAATGTAAACAGG - Intronic
1051205237 9:14681743-14681765 GTGTGTGTGTGTGTGTAAGTGGG + Intronic
1051316219 9:15835849-15835871 ATGCATGTATATATGTAAATAGG - Intronic
1051872579 9:21755785-21755807 GTGTGTGTATGTGTGTAAAGTGG - Intergenic
1051961071 9:22763314-22763336 TTGTTGGTAGGAATGTAAATTGG + Intergenic
1052049644 9:23830595-23830617 GTGTGTGTGTGTGTGTAAGTGGG - Intergenic
1052137358 9:24929588-24929610 TTGTGTCTATGTAGGCATATGGG + Intergenic
1052261886 9:26526232-26526254 CTGTGTGCATGTATGTGCATTGG + Intergenic
1052491317 9:29172903-29172925 GTGTGTGTATGTAAGTATAAGGG - Intergenic
1052503853 9:29327667-29327689 ATATGTGTATATATGTACATAGG + Intergenic
1052611326 9:30778131-30778153 GTGTGTGTATGTGTGTACAGAGG + Intergenic
1052790569 9:32871871-32871893 GTGTGTGTGTGTATGTCAAGGGG - Intergenic
1052809999 9:33049757-33049779 GTGTGTGTGTGTGTGGAAATGGG - Intronic
1053171652 9:35891282-35891304 GTGTGTGTGTGTGTGTAGATAGG - Intergenic
1053325455 9:37143524-37143546 TTCTGTGTATGAAAGAAAATAGG + Intronic
1053360312 9:37481927-37481949 ATGTGTGTAGGTATGCAAAGAGG + Intergenic
1053366494 9:37526073-37526095 GTGTGTGTATGTGTGTACATGGG + Intronic
1053547727 9:39041485-39041507 GTGTGTGTATGTGTGTAGGTGGG - Intergenic
1054841044 9:69740205-69740227 GTGTGTGTATGTATGTATGTAGG + Intronic
1054898972 9:70347214-70347236 GTGTGTGTATGTGTGTGTATGGG - Intronic
1055206187 9:73733291-73733313 TTGTGTGTGTGCATGTGAAGAGG - Intergenic
1055354230 9:75420854-75420876 GTGTGTGTGTGTATTTAGATGGG - Intergenic
1055494933 9:76844600-76844622 GTGTGTGTATGTATGTGGAGGGG - Intronic
1055612133 9:78033401-78033423 GTGTGTGTATGTGTGTGAAACGG - Intergenic
1055767638 9:79681864-79681886 ATGTGTGTGTGTGTGTAATTTGG + Intronic
1055937107 9:81613631-81613653 TTGTGTGGATTTATGAAAATTGG - Intronic
1056068845 9:82964839-82964861 TTGTGTTTATTTTTTTAAATGGG + Intergenic
1056072176 9:82998809-82998831 GTGTGTGTATGTATGTGTGTAGG + Intronic
1056778980 9:89535249-89535271 CTGTGTGTGTGTATGTGTATAGG + Intergenic
1056831719 9:89922745-89922767 GTGTGTGTATGTGTGTGTATAGG - Intergenic
1057017673 9:91666937-91666959 GTGTGTGTGTGTGTGTACATAGG + Intronic
1057412471 9:94829189-94829211 GTGTGTGTGTGTGTGTAAACTGG - Intronic
1057581189 9:96289221-96289243 ATGTGTGTGTGTATGGAAGTGGG + Intronic
1057650818 9:96917914-96917936 GTGTGTGTGTGTGTGTAGATGGG + Intronic
1057754345 9:97819925-97819947 TTGTGTGTGTGTGTGTAGGTGGG + Intergenic
1058020335 9:100079407-100079429 GTGTGTGTGTGTGTGTAAAGGGG - Intronic
1058057725 9:100465900-100465922 GTGTGTGTATGCATGCATATTGG - Intronic
1058292799 9:103263214-103263236 GTGTGTGTATATATGTATAAAGG - Intergenic
1058656547 9:107227258-107227280 TTGTGTGAATAATTGTAAATAGG - Intergenic
1058719911 9:107754466-107754488 GTGTGTGTATATATATATATAGG - Intergenic
1059400703 9:114069095-114069117 ATGTATGTATGTATGTACATGGG - Intronic
1059502654 9:114768220-114768242 ATGTGTGTATGTATGTGTGTGGG + Intergenic
1059502775 9:114769360-114769382 GTCTGTGTATGGAGGTAAATGGG + Intergenic
1059909151 9:119023148-119023170 GTGTGTGTGTGTGTGTACATAGG - Intergenic
1059967445 9:119629315-119629337 GTGTGTGTATAAATGTATATGGG + Intergenic
1060025089 9:120164133-120164155 GTGTGTGTATGTATATATATGGG - Intergenic
1060451167 9:123742054-123742076 TTGTGTTTATGTATGTGCAGAGG - Intronic
1060478535 9:124002423-124002445 GTGTGTGTGTGTAGATAAATAGG + Intronic
1061173676 9:128978253-128978275 TTGTATATAAGTATGTAAGTAGG - Intronic
1061923001 9:133792528-133792550 TTGTGTGTGTGTATGTGAGCAGG + Intronic
1061935301 9:133854177-133854199 TTGTGTGTGTGCAGGTACATGGG - Intronic
1062675694 9:137742321-137742343 GTGTGTGTGTGTAAGTAAAGGGG + Intronic
1203624371 Un_KI270749v1:156889-156911 ATGTATGTATGTATGTGTATAGG + Intergenic
1185742850 X:2547744-2547766 ATGTGTGTATGTGTGTATGTGGG + Intergenic
1185889291 X:3810080-3810102 GTGTGTGTGTGTGTGTAAAATGG - Intergenic
1185937296 X:4273147-4273169 GTGTGTGTGTGTGTGTAAAAAGG - Intergenic
1186057058 X:5661094-5661116 GTGTGTGTATGTGTGTAAGAGGG + Intergenic
1186068655 X:5793739-5793761 ATGAGTTTATGTATGTATATGGG - Intergenic
1186132874 X:6487698-6487720 GTGTGTGTGTGTGTGTAATTAGG - Intergenic
1186290403 X:8091233-8091255 TTGTGTGTATTTATATATATGGG - Intergenic
1186375699 X:8997290-8997312 TTGTGTGTCAGTGTGTAAGTGGG - Intergenic
1186527497 X:10262495-10262517 GTGTGTATGTGTGTGTAAATGGG - Intergenic
1186783649 X:12939322-12939344 GTGTGTGTGTGTATTTAAAAAGG - Intergenic
1187003104 X:15202208-15202230 GTGTGTGTGTGTGTGTAGATTGG - Intergenic
1187045241 X:15641662-15641684 GTGTGTGTGTGTGTGTAAACAGG + Intronic
1187181998 X:16951494-16951516 GTGTGTGTGTGTGTGTAGATGGG - Intronic
1187246440 X:17556773-17556795 TTGTTTGTGTGTATGAAAATCGG + Intronic
1187840674 X:23484066-23484088 GTGTGTGTTTGTATATATATGGG - Intergenic
1188417949 X:29959631-29959653 ATGTGTGTCTGTCTGTAGATGGG - Intergenic
1188501377 X:30830841-30830863 TTGTGTGCATGTATGTGTGTTGG + Exonic
1188732498 X:33668255-33668277 GTGTGTGTGTGTGTGTATATGGG + Intergenic
1188900172 X:35722622-35722644 TTGTGTGTAGAAATGTAAAATGG - Intergenic
1188947595 X:36326294-36326316 GTGTGTGTGTGTTTGGAAATTGG - Intronic
1189149238 X:38687434-38687456 AAGTGTTTCTGTATGTAAATGGG - Intronic
1189296897 X:39924979-39925001 GTGTGTGTGTGTATGTGTATGGG - Intergenic
1189616012 X:42784995-42785017 CTTTTTGTATTTATGTAAATAGG + Intergenic
1189671857 X:43419427-43419449 TTGTGGGTATGTTGGCAAATGGG - Intergenic
1189675004 X:43452677-43452699 GTGTGTGTGTGTGTGTAGATGGG + Intergenic
1190147456 X:47908332-47908354 TTGTATGTATGTATGTGTGTAGG - Intronic
1190264409 X:48818916-48818938 TTGTGTGTATGTCTCTGACTGGG + Intronic
1190709495 X:53056294-53056316 TTGGGTATATGTATGAAAGTAGG + Intronic
1190733416 X:53239388-53239410 GTGTGTGTGTGTCTGTTAATGGG - Intronic
1190920874 X:54851436-54851458 GTGTGTGTGTGTGTGTAAACTGG - Intergenic
1190930524 X:54946017-54946039 GTGTGTGTATGTGTGTGTATAGG + Intronic
1190942753 X:55058331-55058353 GTGTGTGTGTGTTTGTAGATGGG + Intergenic
1191035229 X:56018462-56018484 TTATGTGTATGAATGTGTATTGG + Intergenic
1191077465 X:56470217-56470239 GTGTGTGTGTGTATGTATAGTGG + Intergenic
1191180217 X:57554229-57554251 TTGTGTGTGTGTATGTGTGTGGG - Intergenic
1191666993 X:63713691-63713713 GTGTGTGTGTGTATGTGAAGTGG - Intronic
1192068128 X:67908518-67908540 TTGAGTGTATGTTTGTGAGTGGG - Intergenic
1192095846 X:68209735-68209757 TTATGTGTATGGGTATAAATTGG + Intronic
1192100151 X:68255714-68255736 GTGTGTGTGTGTATGTAGAGCGG - Intronic
1192720411 X:73690758-73690780 TGCTGTGTATGTATGTGAAAAGG + Intergenic
1192801535 X:74469425-74469447 TTGTTTGTAGGAATGTAAAATGG - Intronic
1192934499 X:75845236-75845258 TTTTGAGTGTGTATTTAAATAGG - Intergenic
1193300367 X:79881636-79881658 TTGTGGGTATGCATGTGCATGGG + Intergenic
1193332270 X:80248127-80248149 TTGTGATTATGTAAGTTAATGGG + Intergenic
1193366732 X:80643544-80643566 ATGTGTGTGTGTATATATATAGG + Intergenic
1193474800 X:81949964-81949986 GTGTGTGTTTGTATTTAAAAGGG + Intergenic
1193533218 X:82681595-82681617 TTGTTTGTGGGAATGTAAATTGG - Intergenic
1193538924 X:82746999-82747021 TTGTGTGTATGTATGTATATGGG - Intergenic
1193850337 X:86529936-86529958 GTGTGTGTGTGTATGTACAATGG - Intronic
1193870622 X:86793518-86793540 TTTTATTTATGTTTGTAAATGGG - Intronic
1193891549 X:87051644-87051666 GTGTGTATATATATATAAATAGG - Intergenic
1194080212 X:89453399-89453421 GTGTGTGTATGTAAATAAACTGG + Intergenic
1194246939 X:91525487-91525509 TTTTGTGTATGTTTGGGAATGGG - Intergenic
1194304330 X:92223867-92223889 TTCTGTGTATTTACATAAATGGG + Intronic
1194481244 X:94427263-94427285 GTGTGTGTGTGTATATATATAGG - Intergenic
1194551261 X:95302510-95302532 CTGTGGGCATGTATGTAACTTGG - Intergenic
1194592723 X:95819204-95819226 GTGTGTGTGTGTGTGTAAATGGG - Intergenic
1194814998 X:98430425-98430447 TTGTATATATGTATGTAGGTAGG - Intergenic
1194909298 X:99619500-99619522 TTGTGGGTGGGAATGTAAATTGG + Intergenic
1194988277 X:100515467-100515489 TTGCTGGTATGTATGTAAAATGG - Intergenic
1195131114 X:101853581-101853603 GTGTGTGCATGTATTTATATTGG + Intronic
1195269045 X:103213019-103213041 GTGTGTGTGTGTATGGAGATGGG + Intergenic
1195485357 X:105398492-105398514 GTGTGTGTGTGTATGTAATTAGG + Intronic
1195575536 X:106445774-106445796 TTTTGTGTTGCTATGTAAATGGG + Intergenic
1195671664 X:107475088-107475110 GTGTGTGTGTGTATGTTCATAGG + Intergenic
1195770244 X:108343194-108343216 GTGTGTGTGTGTATGTACAAAGG + Intronic
1195782791 X:108483237-108483259 GTGTGTGTGTGTATGTAAAGGGG + Intronic
1195848050 X:109249445-109249467 GTGTGTGTGTGTGTGTAAAAAGG + Intergenic
1196052408 X:111319429-111319451 TTGTATGTATGTATGTTCTTTGG - Intronic
1196088518 X:111712933-111712955 TTGTATGTATGTCTGTGAGTTGG - Intronic
1196140016 X:112250849-112250871 TTCTGTTTATGTATGTAGTTGGG + Intergenic
1196282308 X:113836281-113836303 GTGTGTGTGTGTGTGTAGATAGG + Intergenic
1196492422 X:116283767-116283789 TTGTGTGTATATATATATACAGG - Intergenic
1196509555 X:116491738-116491760 GTGTGTGTATATATATATATGGG + Intergenic
1196635038 X:117992532-117992554 GTGTGTGTATGTGTGTTGATGGG - Intronic
1196656062 X:118218216-118218238 GTATGTGTATGTGTGTATATGGG + Intergenic
1196744783 X:119061501-119061523 TTGTTTGTGGGAATGTAAATTGG + Intergenic
1196975954 X:121157875-121157897 TTGTGTGTAAGTATGTAGTAGGG - Intergenic
1196979511 X:121196007-121196029 TTTTTTGTGTGTATGTACATGGG + Intergenic
1197048555 X:122030017-122030039 TTATTTTTATGTATGTGAATTGG + Intergenic
1197149089 X:123200574-123200596 GTGTGTATATGTATATATATGGG - Intronic
1197217119 X:123876953-123876975 TTGTGTGTCCATATGTACATTGG - Intronic
1197364571 X:125547831-125547853 TTCATTGTAGGTATGTAAATTGG + Intergenic
1197392867 X:125889994-125890016 GTGTGTGTATATGTGTATATAGG + Intergenic
1197436784 X:126438521-126438543 GTGTGTGCATGTGTGTAAAATGG - Intergenic
1197529443 X:127605160-127605182 GTGTGTGTGTGTGTGTAAAGGGG - Intergenic
1197622937 X:128771460-128771482 TTCTGTGTATCTTTGAAAATGGG - Intergenic
1197659419 X:129154025-129154047 GTGTGTGTATATATATATATGGG + Intergenic
1197827582 X:130606476-130606498 GTGTGTGTATGTATGTGCATGGG - Intergenic
1198182272 X:134221426-134221448 GTGTGTGTGTGTGTGTAGATGGG - Intergenic
1198655560 X:138909857-138909879 TGGTGGGTATATATGTGAATTGG + Intronic
1198691766 X:139292562-139292584 TTGTTTGCTTGTATGTAAAATGG + Intergenic
1199246287 X:145608543-145608565 ATGTATGTGTGTATATAAATCGG - Intergenic
1199776314 X:151015068-151015090 GTGTGTGTGTGTGTGTAGATAGG + Intergenic
1200432888 Y:3109460-3109482 GTGTGTGTATGTAAATAAACTGG + Intergenic
1200565905 Y:4766776-4766798 TTTTGTGTATGTTTGGGAATGGG - Intergenic
1200800465 Y:7382527-7382549 GTGTGTGTGTGTGTGTAGATAGG + Intergenic
1201374501 Y:13302214-13302236 TTTTGTGTATCTTTGTAATTTGG - Intronic
1201681721 Y:16652941-16652963 ATGTGTGTATTTTTTTAAATAGG + Intergenic
1201741654 Y:17330633-17330655 ATGTGTGTATGCATGCAAAGAGG + Intergenic
1202060790 Y:20885718-20885740 TTGAGAGTATGTATGTATACAGG - Intergenic
1202108508 Y:21396249-21396271 TTGAGAGTATGTAGATAAATTGG + Intergenic
1202330918 Y:23751790-23751812 TTTTGTGTATATGTGTGAATTGG - Intergenic
1202539851 Y:25918271-25918293 TTTTGTGTATATGTGTGAATTGG + Intergenic