ID: 967458914

View in Genome Browser
Species Human (GRCh38)
Location 3:189722501-189722523
Sequence TTGAATCCCAAACAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967458909_967458914 0 Left 967458909 3:189722478-189722500 CCTTCACTTCACAGAGGAGGAAC 0: 1
1: 1
2: 16
3: 150
4: 838
Right 967458914 3:189722501-189722523 TTGAATCCCAAACAGGGGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 130
967458908_967458914 1 Left 967458908 3:189722477-189722499 CCCTTCACTTCACAGAGGAGGAA 0: 1
1: 2
2: 24
3: 172
4: 757
Right 967458914 3:189722501-189722523 TTGAATCCCAAACAGGGGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 130
967458904_967458914 24 Left 967458904 3:189722454-189722476 CCTTAGAGCTCAGGGGAATCAAC 0: 1
1: 0
2: 1
3: 7
4: 102
Right 967458914 3:189722501-189722523 TTGAATCCCAAACAGGGGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 130
967458907_967458914 2 Left 967458907 3:189722476-189722498 CCCCTTCACTTCACAGAGGAGGA 0: 1
1: 0
2: 11
3: 92
4: 517
Right 967458914 3:189722501-189722523 TTGAATCCCAAACAGGGGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967458914 Original CRISPR TTGAATCCCAAACAGGGGCA GGG Intronic
900112808 1:1015653-1015675 CTGAACCCCCAACGGGGGCAGGG + Intergenic
901026624 1:6281840-6281862 TTCAATCCCACCAAGGGGCACGG - Intronic
903497536 1:23779767-23779789 CTGAAGCCCATACAGGGGAAGGG + Intronic
905478929 1:38248037-38248059 TTGAACCCCAACCAGGTGCCAGG - Intergenic
906720942 1:48004078-48004100 TTGAATCCCAAATAGAGGAGTGG - Intergenic
909590093 1:77338588-77338610 TTGAAACCAAAACAGTGGAAGGG + Intronic
910465949 1:87500215-87500237 TTGAGTGCCAAACATGGGCCAGG - Intergenic
916172038 1:162008890-162008912 TTGAATCCCACTAAGGGGCCAGG - Intronic
918004265 1:180526890-180526912 TGTTATCCCAACCAGGGGCAAGG - Intergenic
921028910 1:211319181-211319203 TTGATTCTCAAACTGGGGAAGGG - Intergenic
923722321 1:236477552-236477574 TGGAATTCCAGACAGGGGCCGGG + Intronic
1063755949 10:9008630-9008652 GTAAATCCCAAGCAGGGCCAGGG + Intergenic
1064628852 10:17288498-17288520 TTGAATCCTTAAAAGGTGCAGGG - Intergenic
1065894863 10:30154392-30154414 GTGAAGCCCAGACAGGGTCAGGG + Intergenic
1066005657 10:31144186-31144208 TTGAATCCCAAAGGAGGGGATGG + Intergenic
1067688791 10:48487147-48487169 TGGAATCTCAAGCAGGGACAGGG - Intronic
1067729284 10:48797985-48798007 TTGAAACCTAAACTGAGGCAAGG + Intronic
1070519467 10:77239332-77239354 TTGTATCTCAAACTGGGCCATGG + Intronic
1071792793 10:88973525-88973547 TTGCATCCCAAACAGAGCCAAGG - Intronic
1073329307 10:102660454-102660476 TTTAGCCCCAAACAGGTGCACGG - Intergenic
1074567465 10:114593827-114593849 TTGAATTCCAAACTGGAACAGGG - Intronic
1075541635 10:123318701-123318723 TCAAAAACCAAACAGGGGCAGGG + Intergenic
1077109892 11:857696-857718 TTAAAACCCAAACTGGGGCCGGG - Intronic
1078134320 11:8639821-8639843 ATGAATCCCAGACAGGGGGAGGG - Intronic
1079308304 11:19344003-19344025 CTGCATCCCAAATAGGGGCCCGG + Intergenic
1080184572 11:29465713-29465735 TTGATTACCAAACTGGGGAATGG + Intergenic
1083227784 11:61295382-61295404 CCGACTCCCAAACCGGGGCAGGG - Exonic
1084022767 11:66427633-66427655 TTGAAGCCCAAACAGCCACAAGG + Intergenic
1086024056 11:82268678-82268700 CTGAATCCCAAACTGGGGATGGG - Intergenic
1090177706 11:124665856-124665878 ATGCATGCCAACCAGGGGCAGGG + Intronic
1090558070 11:127898512-127898534 TTGGATCCCATGCTGGGGCAGGG + Intergenic
1091036225 11:132236643-132236665 TTGAATCAAAATCAGAGGCAGGG + Intronic
1093371395 12:18370152-18370174 TGGCATCCCTAATAGGGGCAGGG - Intronic
1096513604 12:52144953-52144975 CAGAATCCCAGACAGGGGCAAGG - Intergenic
1104378129 12:128283318-128283340 CTGATTCCAAAACTGGGGCAGGG - Intronic
1105812830 13:24009811-24009833 TTGAATTCCAAAAAGGAGGAGGG + Intronic
1106056346 13:26241218-26241240 TTGTGTCCCAACCAGGGGCCAGG + Intergenic
1106062272 13:26305554-26305576 TTGAATCCCAAAAAGAGAGAGGG - Intronic
1108344005 13:49526298-49526320 TGTAATCCAAAACAGGGGAAAGG - Intronic
1109203347 13:59454897-59454919 TTGTCTCCCAAAAAGAGGCAAGG + Intergenic
1109588651 13:64445191-64445213 ATGCAACCCAAACATGGGCAAGG + Intergenic
1112471476 13:99693614-99693636 CTGAAACCCAAGCAGAGGCAAGG + Intronic
1112553644 13:100446323-100446345 TTTAAAAACAAACAGGGGCAGGG - Intronic
1117980518 14:61338209-61338231 CTGAATCCCAAACATGTGCAGGG - Intronic
1119334934 14:73825194-73825216 CTAAAGCCCAAACAGTGGCATGG + Intergenic
1121225801 14:92321236-92321258 TTGAATCCAAAACAGGTCAAAGG - Intergenic
1121494979 14:94385870-94385892 TTGAAGCCCAGAGAGGGTCAGGG + Intronic
1122471574 14:101970776-101970798 TAAAATCCCAAACATGGGCTGGG - Intronic
1129239342 15:74242392-74242414 TTGAGGCCCAGACAGGAGCAAGG - Intronic
1131833660 15:96369679-96369701 GTGAATCCCAAACAGCTGTAAGG - Intergenic
1132817359 16:1837522-1837544 TTAAATCCAAAACAGGGGAAAGG - Intronic
1137474613 16:48796940-48796962 CTGAAGCCCTCACAGGGGCAAGG + Intergenic
1138432029 16:56975161-56975183 ATAAACCCCACACAGGGGCAGGG - Intronic
1139544644 16:67644670-67644692 TTGGATCCCTAACAGGGTCACGG + Intergenic
1140881199 16:79199655-79199677 ATGAATCCCATACAGGGGCCAGG - Intronic
1142576373 17:911206-911228 AAAAATCCCAAGCAGGGGCAGGG - Exonic
1143605812 17:7985006-7985028 TAAAAACCCAAACAGGGGCCAGG - Intergenic
1145243747 17:21254114-21254136 CTGAATCCCAGAAAGGGGCAGGG + Intergenic
1148372839 17:47113832-47113854 TTGAATCCCAAACAAATTCAGGG - Intergenic
1148864342 17:50620756-50620778 CTGAATCCCAACAAGAGGCAAGG - Intronic
1150225253 17:63521187-63521209 TTGAAACCTGGACAGGGGCAGGG - Intronic
1150587326 17:66530885-66530907 TTTAATCCATACCAGGGGCAAGG - Intronic
1150713553 17:67551877-67551899 TTTAAGCCCAAACACTGGCAGGG - Intronic
1152058252 17:78049671-78049693 TGGACTGCCAAACTGGGGCATGG + Exonic
1158131600 18:54158404-54158426 TTGAAGCCAAAACAGAGGGAGGG - Intronic
1158895807 18:61911787-61911809 TTGAACCCCAAACACTGGAAAGG + Intergenic
1159121168 18:64173192-64173214 TTGAAGCCCAATCTAGGGCAAGG - Intergenic
1161839988 19:6674251-6674273 ATGAATCCCAAACAGGAGAAAGG + Intergenic
1161956958 19:7501442-7501464 GTGGTTCTCAAACAGGGGCAAGG + Intronic
1166682456 19:44777421-44777443 TTGATTCTCAAAAAGGAGCAGGG - Intergenic
1166863810 19:45824301-45824323 GTGAATGCCAAACAGGAGCCAGG + Intronic
1167208358 19:48117595-48117617 CAGAATCCCACACAGGGCCACGG + Intronic
928639898 2:33287264-33287286 TTGATTCCCAAACAAGTGAATGG + Intronic
931457468 2:62423542-62423564 TCCAACCCCACACAGGGGCATGG + Intergenic
931819970 2:65941967-65941989 AAGAATTCCAAACTGGGGCAGGG - Intergenic
931927865 2:67094663-67094685 TTAAATTCCAAAGAGAGGCAGGG - Intergenic
932574545 2:72955528-72955550 TTGAAGCAGAAACAGAGGCAGGG + Intronic
937103554 2:119290092-119290114 GTGACTCCCATGCAGGGGCAGGG - Intergenic
937336912 2:121067883-121067905 CTGAATCCCACACAGTGCCAAGG + Intergenic
937341146 2:121091401-121091423 TTACATCCCAAAGAGGGGGAAGG + Intergenic
939742414 2:145925145-145925167 TTGTATCCCACACAGTGGAATGG - Intergenic
940823876 2:158387911-158387933 TTGGAGCCCAAAAAGGGGAAAGG - Intronic
942963196 2:181857912-181857934 AGGGATCACAAACAGGGGCAAGG - Intergenic
944477251 2:200119474-200119496 TGGATTCCCAAACAGCTGCAGGG + Intergenic
948172072 2:235911825-235911847 GTTAATCCCACACAGGGGCCTGG + Intronic
948368831 2:237475004-237475026 TTGAATCCCACAAAAGGGCGGGG + Intergenic
1172876632 20:38168304-38168326 CTGAAACCCAGAGAGGGGCAAGG - Intergenic
1173485291 20:43436662-43436684 TTCCATCCCATACTGGGGCAAGG - Intergenic
1173870869 20:46341410-46341432 TTCAAGCCCAGACGGGGGCAAGG - Intergenic
1175955524 20:62607068-62607090 TGGAATCCCAAACTGGGAGACGG + Intergenic
1175961137 20:62636964-62636986 TTTAAGCCTACACAGGGGCAAGG - Intergenic
1179621099 21:42617038-42617060 TTGAACCCCTCACACGGGCACGG + Intergenic
1181278282 22:21700768-21700790 TTGAAAACCAAACTGGGGCCGGG - Exonic
1181785167 22:25221590-25221612 CTGAGTCCCAGAGAGGGGCAGGG - Intronic
953273299 3:41468337-41468359 GTAAGTCCCAAACAGGGGCAAGG + Intronic
966673987 3:182564998-182565020 TAGAAACCCAAACTGGGGAAAGG - Intergenic
967135803 3:186511712-186511734 CTGAGCCCCAAACAGGGGCAGGG - Intergenic
967458914 3:189722501-189722523 TTGAATCCCAAACAGGGGCAGGG + Intronic
968280530 3:197473670-197473692 TAGAATCCCAAATAAAGGCAAGG - Intergenic
972193501 4:36624483-36624505 TTGAATCACTAACTGGGGCGAGG + Intergenic
972257618 4:37375042-37375064 TTGCTTCCAAAACATGGGCAAGG + Intronic
974828590 4:67161253-67161275 ATGAACACCTAACAGGGGCAAGG + Intergenic
979406429 4:120316622-120316644 TTGAATCCCAAATCTTGGCAAGG - Intergenic
984499377 4:180539042-180539064 TTTAATCCCAACCAGAGGAAAGG - Intergenic
985657244 5:1138736-1138758 TTGAAACCAAAACAGGATCAAGG + Intergenic
990211928 5:53490185-53490207 CTGAAGCCCTAACAGTGGCATGG - Intergenic
990286467 5:54305202-54305224 TTAAATCCCAAACACTGGCAGGG + Intronic
991261563 5:64674047-64674069 CTGAAGCTCAAACAGGGGCTTGG + Intergenic
991585230 5:68195237-68195259 TTGTATTCCATACAGGGACAGGG - Intronic
993013130 5:82506707-82506729 ATGAATCCGCAACTGGGGCAGGG + Intergenic
997633535 5:135387830-135387852 CTGAGTCCCAGACTGGGGCAAGG + Intronic
998957530 5:147453317-147453339 AGGAAACCCAAACAGTGGCACGG - Intronic
1000935023 5:167297004-167297026 TTAAATCCCAATCTGTGGCAGGG + Intronic
1005273237 6:24188467-24188489 TTGACTCTTAAACAGTGGCATGG - Intronic
1005323298 6:24676729-24676751 TTGAAGCCAAAAGAGCGGCAAGG - Intronic
1005688135 6:28274936-28274958 TTCAGTCCTACACAGGGGCAGGG - Intronic
1007968805 6:46029869-46029891 TTTAATCCCTAACAGGAGCAGGG - Intronic
1008392981 6:50974448-50974470 AGAATTCCCAAACAGGGGCAGGG - Intergenic
1012137195 6:95572998-95573020 TTGCATCCCAAACTGTGTCAAGG + Intergenic
1017437683 6:154432694-154432716 TTGAATGCCAAACACTGACAAGG + Intronic
1026906018 7:74063230-74063252 TTGAAACCCCAGGAGGGGCAGGG + Intronic
1026996707 7:74621666-74621688 TTTAAAACCAAACAGGGGCCGGG - Intergenic
1027706625 7:81542286-81542308 TTGAATCCCTCACAGTGCCAGGG - Intergenic
1029248869 7:99221980-99222002 TTGAAGACCAAACATGGACACGG - Intergenic
1032330982 7:130979226-130979248 TTGAAGCCACAGCAGGGGCAAGG + Intergenic
1043013670 8:74911283-74911305 TCGTATCCCAAACAGTGCCATGG + Intergenic
1048099840 8:131338963-131338985 TTGATTCCCAAACCCAGGCATGG - Intergenic
1050623618 9:7480256-7480278 TTGAAAGCCAAAATGGGGCAGGG + Intergenic
1051376226 9:16405307-16405329 TTAAAACCCAGACAGGTGCATGG - Intergenic
1051848289 9:21477684-21477706 TTGAATCAGAAACAGTGGGATGG + Intergenic
1052824685 9:33166608-33166630 TTAAATCCCAGACAGAGGCTTGG - Intronic
1056365870 9:85904101-85904123 TTGAATTCTAAACAGAGGCCTGG + Intergenic
1056458594 9:86787695-86787717 GAGGATCCCAAACAGGGACAAGG + Intergenic
1059786728 9:117594298-117594320 TTGGGTCCCAAACAGGGTGAAGG - Intergenic
1060072813 9:120565178-120565200 CTGAAGCCCAGACAGGGGTAGGG - Intronic
1060302003 9:122379590-122379612 TTGAGACCCAAGCAGGGACATGG - Intronic
1185626056 X:1483337-1483359 TTAAAACCCAAACAGGAGCCAGG + Intronic
1190842191 X:54155537-54155559 TTGAAAAGCAAACAGGGGAAGGG + Intronic
1191860694 X:65664719-65664741 TAGAAGTCCAAGCAGGGGCAGGG - Intronic
1195816165 X:108891531-108891553 TTGTATGGCAAACAGGGGCCAGG + Intergenic
1196594116 X:117523139-117523161 TTGAACCCCAAACAGGAGCTAGG + Intergenic
1196803742 X:119566400-119566422 TTGAATCACAAACAGTGTCAAGG - Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1198178560 X:134181416-134181438 TTGCATCTCAAAGAGGGGGAGGG + Intergenic
1199813583 X:151375801-151375823 TTGAATCCCAAAGCAGTGCAGGG - Intergenic
1201571166 Y:15415949-15415971 CTGGATTCAAAACAGGGGCAAGG - Intergenic