ID: 967461633

View in Genome Browser
Species Human (GRCh38)
Location 3:189754276-189754298
Sequence ATGCAAGGATGGAGGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2267
Summary {0: 1, 1: 0, 2: 9, 3: 183, 4: 2074}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967461633 Original CRISPR ATGCAAGGATGGAGGAAAGA AGG (reversed) Intronic
Too many off-targets to display for this crispr