ID: 967462925

View in Genome Browser
Species Human (GRCh38)
Location 3:189767056-189767078
Sequence TTGTTATATGGCAAGATTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2412
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 2383}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967462925_967462930 25 Left 967462925 3:189767056-189767078 CCACAAATCTTGCCATATAACAA 0: 1
1: 0
2: 2
3: 26
4: 2383
Right 967462930 3:189767104-189767126 TTTGCTTTCATACAAACAAAAGG 0: 1
1: 0
2: 1
3: 30
4: 511

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967462925 Original CRISPR TTGTTATATGGCAAGATTTG TGG (reversed) Intronic
Too many off-targets to display for this crispr