ID: 967462930

View in Genome Browser
Species Human (GRCh38)
Location 3:189767104-189767126
Sequence TTTGCTTTCATACAAACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 511}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967462928_967462930 -5 Left 967462928 3:189767086-189767108 CCCATAACTTTTTGTTTGTTTGC 0: 1
1: 0
2: 13
3: 147
4: 1024
Right 967462930 3:189767104-189767126 TTTGCTTTCATACAAACAAAAGG 0: 1
1: 0
2: 1
3: 30
4: 511
967462926_967462930 13 Left 967462926 3:189767068-189767090 CCATATAACAAATCTTTCCCCAT 0: 1
1: 0
2: 2
3: 31
4: 348
Right 967462930 3:189767104-189767126 TTTGCTTTCATACAAACAAAAGG 0: 1
1: 0
2: 1
3: 30
4: 511
967462927_967462930 -4 Left 967462927 3:189767085-189767107 CCCCATAACTTTTTGTTTGTTTG 0: 1
1: 3
2: 47
3: 342
4: 1984
Right 967462930 3:189767104-189767126 TTTGCTTTCATACAAACAAAAGG 0: 1
1: 0
2: 1
3: 30
4: 511
967462929_967462930 -6 Left 967462929 3:189767087-189767109 CCATAACTTTTTGTTTGTTTGCT 0: 1
1: 2
2: 28
3: 267
4: 1826
Right 967462930 3:189767104-189767126 TTTGCTTTCATACAAACAAAAGG 0: 1
1: 0
2: 1
3: 30
4: 511
967462925_967462930 25 Left 967462925 3:189767056-189767078 CCACAAATCTTGCCATATAACAA 0: 1
1: 0
2: 2
3: 26
4: 2383
Right 967462930 3:189767104-189767126 TTTGCTTTCATACAAACAAAAGG 0: 1
1: 0
2: 1
3: 30
4: 511

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967462930 Original CRISPR TTTGCTTTCATACAAACAAA AGG Intronic
900044871 1:497733-497755 ATTCCTTACAAACAAACAAAAGG - Intergenic
900066273 1:732641-732663 ATTCCTTACAAACAAACAAAAGG - Intergenic
900066671 1:736047-736069 ATTCCTTACAAACAAACAAAAGG - Intergenic
900067067 1:739463-739485 ATTCCTTACAAACAAACAAAAGG - Intergenic
906870732 1:49477382-49477404 CTTACTTTCTTCCAAACAAATGG - Intronic
907023881 1:51095658-51095680 TTTACTTTCTGTCAAACAAATGG - Intergenic
908781439 1:67694400-67694422 TTTTCTTTCTTACAAAAATAGGG - Intergenic
908811663 1:67987641-67987663 TCTGCTTTCCTGCAAAGAAAAGG + Intergenic
909511706 1:76460747-76460769 TTTGATTTAATACATAGAAATGG + Intronic
910639648 1:89446177-89446199 CTTACTTTCACCCAAACAAATGG + Intergenic
910797510 1:91113664-91113686 TTGGCTTTTATCCAAACAACAGG + Intergenic
911356764 1:96831555-96831577 TATCCTTTCATGAAAACAAAAGG + Intergenic
911975277 1:104487255-104487277 CTTGCTTTCTTACAAAAAGACGG - Intergenic
912060509 1:105662677-105662699 TATGCTTTCATAGAAAATAAGGG + Intergenic
912698617 1:111859720-111859742 TCAGCTTTCATGGAAACAAATGG - Intronic
912880467 1:113407231-113407253 TTTATTTTCATCCAAACTAAAGG - Intronic
913684359 1:121217102-121217124 TATGATTTCAAAGAAACAAAAGG - Intronic
913954660 1:143277731-143277753 TTTCCTTTGATATAAATAAAGGG + Intergenic
913982779 1:143537626-143537648 TTTCCTTTGATATAAATAAAGGG - Intergenic
914036198 1:144004717-144004739 TATGATTTCAAAGAAACAAAAGG - Intergenic
914153259 1:145063228-145063250 TATGATTTCAAAGAAACAAAAGG + Intronic
914925379 1:151881523-151881545 GGTGCTGTCATTCAAACAAATGG - Intronic
915880506 1:159666401-159666423 TTTGCTTTCATTAAAACTACAGG - Intergenic
917047702 1:170880714-170880736 GTTGCTTTCAACCAAAGAAATGG + Intergenic
918331124 1:183461543-183461565 TTTACTTTCTTACCCACAAATGG + Intergenic
918954212 1:191183900-191183922 TTTGATGGCATACAAATAAAGGG - Intergenic
919257432 1:195142289-195142311 TTTGCTTTCTCCCAAACAAATGG + Intergenic
920471668 1:206235615-206235637 TATGATTTCAAAGAAACAAAAGG - Intronic
920607519 1:207403512-207403534 TTTACTGTGATACACACAAAAGG - Intergenic
921445204 1:215238446-215238468 TTTGTTTTTATATAAACTAAAGG + Intergenic
921662709 1:217825627-217825649 TTTTCTTTCATACATACACCAGG - Intronic
921794294 1:219325054-219325076 TTTGTTTTCAAAAAAACATATGG + Intergenic
921823241 1:219641250-219641272 CTTACTTTCCTCCAAACAAATGG - Intergenic
921916596 1:220618869-220618891 TTTCCCTACCTACAAACAAAAGG - Intronic
922101390 1:222479989-222480011 ATTCCTTACAAACAAACAAAAGG - Intergenic
922194471 1:223347844-223347866 TTTGCTTTCCTCCAGACAACTGG - Intronic
922262471 1:223955101-223955123 ATTCCTTACAAACAAACAAAAGG - Intergenic
922748809 1:228061294-228061316 ATTTCTTTCATAGAAAGAAAAGG - Intergenic
923027143 1:230214083-230214105 GATGTTTTCAGACAAACAAAAGG - Intronic
923960182 1:239072249-239072271 GTTGCTTTCTCCCAAACAAATGG - Intergenic
924344311 1:243060101-243060123 ATTCCTTACAAACAAACAAAAGG - Intergenic
924451559 1:244183420-244183442 TGTGCTTTCATAGGACCAAATGG - Intergenic
924745371 1:246828360-246828382 TTTGTTTTATTACAAACACAGGG - Intergenic
1064714667 10:18164367-18164389 ATTGCTCTCCCACAAACAAATGG - Intronic
1065053895 10:21823621-21823643 TTTACTTACATATAAACCAAGGG + Intronic
1066180971 10:32960080-32960102 TGTGATTTCATACAAATAATGGG + Intronic
1066732022 10:38444959-38444981 ATTCCTTACAAACAAACAAAAGG + Intergenic
1067984322 10:51124732-51124754 TTTGTTTGCTTACAAAAAAACGG + Intronic
1068164221 10:53306649-53306671 TTTCCTTTCTTGCATACAAATGG - Intergenic
1068478659 10:57562138-57562160 CTTCCTTTCTTCCAAACAAATGG + Intergenic
1068956392 10:62822056-62822078 TTTGCTTTTATACTGACAAAAGG + Intronic
1069018867 10:63464418-63464440 TAAGCTTTCATGCACACAAAGGG + Intronic
1069140942 10:64824825-64824847 TCTACGTTCATACAAACAATGGG + Intergenic
1069208868 10:65731308-65731330 TTTTCCCTTATACAAACAAATGG - Intergenic
1070450104 10:76549334-76549356 TTTCCTTCCCTACAAACAAGTGG + Intronic
1070688580 10:78508141-78508163 TTTGCTTGCATCCAAATGAAAGG + Intergenic
1071727189 10:88211048-88211070 TTTCCTTTCACAAAAAGAAAGGG - Intergenic
1071928019 10:90433670-90433692 TTTATTTTCACACAAACAAAAGG + Intergenic
1072842727 10:98793322-98793344 TTTGCTATCATAAAATCAACTGG + Intronic
1073382356 10:103089011-103089033 TGTGCTATTAAACAAACAAAAGG + Exonic
1074549737 10:114431367-114431389 TTTGCTTTCATATTTCCAAAAGG + Intronic
1074984504 10:118645130-118645152 TTTCCATTGACACAAACAAATGG - Intergenic
1075429728 10:122370279-122370301 CTTGCTGTCATCCAAACATACGG - Intergenic
1076491758 10:130866594-130866616 TTGGCTTTCAGACAGACAAGGGG - Intergenic
1076971198 11:134224-134246 ATTCCTTACAAACAAACAAAAGG - Intergenic
1078730294 11:13967483-13967505 TTTGTTTCCCCACAAACAAAAGG - Intronic
1079034008 11:17006926-17006948 TTTGATTTCAGACTAAAAAATGG + Intronic
1079069137 11:17328224-17328246 CTTACTTTCTTCCAAACAAATGG + Intronic
1079365870 11:19809078-19809100 TTTGCTTTGATCCATTCAAAAGG - Intronic
1079416005 11:20237392-20237414 CTTGCTTTCTCCCAAACAAATGG + Intergenic
1080163940 11:29214065-29214087 TTTGGCTTCATACAAACATTAGG - Intergenic
1080324295 11:31051752-31051774 GTCGTTTTCAGACAAACAAATGG + Intronic
1081069305 11:38590199-38590221 TCTGTTTTCTTACAAATAAAGGG + Intergenic
1081126046 11:39323354-39323376 TTTGCATTGGTAAAAACAAAAGG + Intergenic
1081318858 11:41665961-41665983 TTTGCAATCATAAAAAAAAAAGG + Intergenic
1081335925 11:41866911-41866933 TTTGTTTGCATACAAAAAAGTGG - Intergenic
1081357453 11:42129651-42129673 TTTGATTTCAAAAAAATAAAAGG - Intergenic
1082261747 11:50081435-50081457 GTTCCTTACAAACAAACAAAAGG - Intergenic
1082572837 11:54763666-54763688 TCTCCTTTAATACAAACGAAAGG + Intergenic
1086033214 11:82384685-82384707 TTTACTTTCTCCCAAACAAATGG - Intergenic
1086323941 11:85679519-85679541 TATGCTGACATACCAACAAAAGG - Intronic
1086654493 11:89336149-89336171 TTTGTTTAAAAACAAACAAATGG - Intronic
1086906295 11:92422028-92422050 TTTGCTCACTTACAGACAAAGGG - Intronic
1087935802 11:104033596-104033618 TTTGCTTTATGAAAAACAAAAGG + Intronic
1087945887 11:104159737-104159759 TTTGCTTTCATTCACTGAAAGGG + Intronic
1088308174 11:108432627-108432649 TTTGCTTTAACATAAGCAAATGG - Intronic
1088845985 11:113668261-113668283 TTTGCCTTCATAAAAGCAACAGG - Intergenic
1089894576 11:121917094-121917116 TTTGCATCCATTCAAATAAAAGG + Intergenic
1091620843 12:2087680-2087702 TGTGCTTTCCTAGAAAAAAATGG + Intronic
1092186599 12:6484535-6484557 TTTGATTTAATACAAAGTAAAGG - Intergenic
1092756667 12:11770045-11770067 TTTCCTTTCAATCAAAAAAAAGG + Intronic
1092999018 12:13978160-13978182 AATGCTTTCATACATACAGATGG - Intronic
1093188371 12:16048134-16048156 ATTGCTTTCTTTCACACAAAAGG - Intergenic
1094163032 12:27411892-27411914 TTTGGTGTCATACCAAGAAATGG + Intronic
1094240711 12:28220647-28220669 TTTTTTTTCAGATAAACAAAGGG - Intronic
1094373589 12:29765959-29765981 TTTGCTTTCAACCAAATTAAAGG - Intronic
1094778889 12:33766553-33766575 TATGCTTTAAAACAAACATATGG + Intergenic
1096787120 12:54023474-54023496 TTTGCTTTATTACAATTAAACGG - Intronic
1097537000 12:60884818-60884840 ATTTATTTCAAACAAACAAATGG - Intergenic
1098239808 12:68455746-68455768 TGTGCTTTAATAAAAACTAAAGG - Intergenic
1098725080 12:73954074-73954096 TTTGCTTTGATCTGAACAAATGG - Intergenic
1099378707 12:81927004-81927026 AATGCTTTCAGACAAAAAAAGGG + Intergenic
1099533870 12:83822179-83822201 TAAGCTTTCTTACAAATAAAAGG + Intergenic
1099537581 12:83863630-83863652 TTTCCTTTTACCCAAACAAATGG - Intergenic
1099617377 12:84954127-84954149 TTTCATTTGATACAAACGAAAGG - Intergenic
1099833137 12:87871269-87871291 TGTGCTCTCATACAAAGGAATGG + Intergenic
1100905027 12:99287216-99287238 CTCGCTTTCCTCCAAACAAATGG - Intronic
1101121726 12:101587945-101587967 CATGCTTTCAAACAACCAAAAGG + Intronic
1101281076 12:103256397-103256419 TGTGCCCTGATACAAACAAATGG + Intronic
1101882937 12:108638427-108638449 GTTGCTTTCATTCGAACAAAAGG - Intergenic
1102756626 12:115346776-115346798 TGTGGGTTCATACAAAGAAAAGG - Intergenic
1103461512 12:121108411-121108433 CTTGCTTTCTTCCAAACAAATGG - Intergenic
1104103030 12:125633754-125633776 CTTACTTTCTTCCAAACAAATGG + Intronic
1104166427 12:126234642-126234664 TTTTCCTTCATACAAAAAAGTGG + Intergenic
1106476571 13:30103701-30103723 TCTCCTTTCATGGAAACAAAAGG + Intergenic
1106681740 13:32015466-32015488 AATTCTTTCATACAAACCAAAGG - Intergenic
1107460357 13:40596163-40596185 TTAGCTTTCATGCAAACACTTGG - Intronic
1108016587 13:46083154-46083176 TTAGCTATCATACTAATAAAGGG + Intronic
1108540803 13:51442883-51442905 TTTACTTTCTGCCAAACAAAGGG + Intronic
1109060383 13:57610698-57610720 TTTGGTTTTATTTAAACAAAAGG + Intergenic
1109266294 13:60204688-60204710 TAGGTTTTCATACAAACTAAAGG - Intergenic
1109324833 13:60854333-60854355 TTTGTTTTTATACAAAGTAAAGG - Intergenic
1109961538 13:69638536-69638558 CTTACTTTCTTCCAAACAAAAGG + Intergenic
1110045654 13:70826969-70826991 TTTGTTTTAATACAAGGAAAGGG + Intergenic
1110078826 13:71286014-71286036 TTTACTTTCTTGCAAACCAATGG + Intergenic
1110121718 13:71890070-71890092 TTTGCTTTAATGCAAGCAGATGG - Intergenic
1110311966 13:74060249-74060271 TTTGTTTTCATATAAACTTAAGG + Intronic
1110311971 13:74060383-74060405 TTTTAATTGATACAAACAAATGG - Intronic
1110431954 13:75434806-75434828 GTTGCTTTCATACTAAGAAGAGG + Intronic
1110548749 13:76787822-76787844 TTTGAATTCATAGAAGCAAAGGG + Intergenic
1110920556 13:81079288-81079310 TTGGCTTACATACATACAACTGG - Intergenic
1110925679 13:81148531-81148553 TTTGCTTTCAAATAAACAGTAGG - Intergenic
1111589557 13:90326067-90326089 TTTTCTTCCACATAAACAAATGG - Intergenic
1112422951 13:99269500-99269522 TTTGCTTTCTTATAAGCAAGGGG + Intronic
1113084229 13:106551081-106551103 GTTTCTTCCACACAAACAAAAGG + Intronic
1113155450 13:107315141-107315163 TTTATTTTGATACAAAGAAAGGG - Intronic
1115093205 14:29603344-29603366 TTTTCTTGCATTGAAACAAATGG + Intronic
1115394921 14:32897648-32897670 TTTTTTTTCAGACAATCAAATGG - Intergenic
1115928199 14:38461200-38461222 TAAGCTTTGAGACAAACAAAAGG + Intergenic
1116438919 14:44928534-44928556 TTTGTTTTAAAACAAACAAAGGG - Exonic
1117228798 14:53693577-53693599 TTTACTTTCAAACCAAAAAAAGG + Intergenic
1118016478 14:61666330-61666352 ATTGTTGTCATACAAATAAATGG - Intergenic
1120145561 14:80975034-80975056 TTTCCTTTAATAGATACAAAAGG - Intronic
1121164906 14:91784981-91785003 TTTGCTTTAATACAAATAGTTGG - Intronic
1121859645 14:97305071-97305093 ATTGCTTTAATACAATAAAAAGG - Intergenic
1124861278 15:33444311-33444333 TTTGCTTTCTGAAAAACCAAAGG + Intronic
1125229925 15:37442155-37442177 TTTGGTTCCAGAAAAACAAAGGG + Intergenic
1125380920 15:39085760-39085782 TTAGCTAACATAGAAACAAAAGG - Intergenic
1125650903 15:41316829-41316851 TTTCCTTTCATAAAACTAAAAGG - Intronic
1126032674 15:44515251-44515273 TTTGCTTTCAAAAAAAGCAAGGG - Intronic
1126124269 15:45281031-45281053 CTTGCTTCCAGACAAGCAAATGG + Intergenic
1126706990 15:51414962-51414984 TTTACTTTCTCCCAAACAAATGG - Intergenic
1127044803 15:55014165-55014187 TTAGCTTTCAGAGAAAGAAAAGG - Intergenic
1127365799 15:58288524-58288546 TTTCCTTTCTGACAAAAAAAAGG - Intronic
1127676174 15:61241518-61241540 TTTGCTTACACTAAAACAAAGGG - Intergenic
1127706392 15:61551352-61551374 TTTTTTTTCACACACACAAAAGG - Intergenic
1127887910 15:63219754-63219776 TTTTCTTTCATGGAAAAAAAGGG - Intronic
1128010630 15:64292487-64292509 TTTACTTGCATACAACAAAATGG - Intronic
1129115186 15:73361705-73361727 TTAGCTTTCATACAAATGATGGG - Intronic
1129905463 15:79184165-79184187 TATAATTTCATTCAAACAAAGGG - Intergenic
1131648822 15:94376363-94376385 ACAGCTATCATACAAACAAAAGG - Intronic
1131954133 15:97713443-97713465 TTTGCTTTTATACAAATATTAGG - Intergenic
1134045216 16:11096024-11096046 TTTGTTTTCTTACAAAGACAAGG - Intronic
1134340426 16:13340229-13340251 TCTGCCTACATACACACAAATGG + Intergenic
1135649746 16:24195718-24195740 TTTGCTTTAAAACACCCAAATGG + Intronic
1138048941 16:53755535-53755557 GATGATTTCATTCAAACAAATGG - Intronic
1138063151 16:53912551-53912573 TTTGCTTTTATCAAAACAAAAGG - Intronic
1138063152 16:53912554-53912576 TTTGTTTTGATAAAAGCAAATGG + Intronic
1138803009 16:60057847-60057869 TTTGCTTTAATTCAGAAAAATGG + Intergenic
1139302029 16:65953648-65953670 TTTGCTTTAAAAAAAAAAAATGG - Intergenic
1140196310 16:72858491-72858513 TTCTCTTTCATAGAAGCAAATGG + Intronic
1141016096 16:80451228-80451250 TTTGCTTACATGGAAACAGAAGG - Intergenic
1141332130 16:83120382-83120404 TGTGTTTTCATACCCACAAATGG - Intronic
1141842474 16:86582447-86582469 TCTGCTCTCATCTAAACAAAGGG + Intergenic
1142449055 16:90163296-90163318 ATTCCTTACAAACAAACAAAAGG + Intergenic
1142458040 17:68584-68606 ATTCCTTACAAACAAACAAAAGG - Intergenic
1142458436 17:71991-72013 ATTCCTTACAAACAAACAAAAGG - Intergenic
1148326606 17:46786673-46786695 TCTGCCTTCAGACACACAAAGGG + Intronic
1149023052 17:51992199-51992221 TTTGCTTTACTATAAAAAAAAGG + Intronic
1149247823 17:54732187-54732209 TTTGAGATGATACAAACAAATGG + Intergenic
1150024867 17:61663474-61663496 GGTGCTTACATACAAACAAATGG - Intergenic
1150055894 17:62015476-62015498 GTTGCTTTCTTTCACACAAATGG - Intronic
1153074782 18:1149313-1149335 CTTACTTTCCTCCAAACAAACGG - Intergenic
1153389090 18:4534239-4534261 TTTACTTTCTTCCAAAAAAATGG + Intergenic
1153628606 18:7045965-7045987 TTTACTTTCTTACAGACAGAAGG + Intronic
1154061519 18:11065306-11065328 TTTCCTTTCATGTAAACATACGG + Intronic
1154108989 18:11549936-11549958 TTGGCTTCCATACCAGCAAAAGG + Intergenic
1155533919 18:26795657-26795679 TTTACTTTCTTCCACACAAATGG - Intergenic
1155621750 18:27787250-27787272 ATTGCTTTAATAGAAACAGAGGG + Intergenic
1156007331 18:32458365-32458387 TTTGATTTCATACAATGCAAGGG + Intronic
1156656939 18:39299421-39299443 TGTGGTTTTATACAAACAACAGG + Intergenic
1157202373 18:45669868-45669890 TTTTCTTTCATTCAATCACACGG + Intronic
1158980723 18:62758458-62758480 TTTGCTTTTATCTAAAGAAACGG - Intronic
1159332404 18:67014600-67014622 TTTGCTTGAGTACAATCAAACGG + Intergenic
1159538206 18:69741940-69741962 TTTTCTTTCATAGTAAGAAATGG - Intronic
1159654126 18:71011698-71011720 TTTGCTTACATAAGAACACAGGG + Intergenic
1159984982 18:74831269-74831291 AATGCTTTTATCCAAACAAAAGG - Intronic
1160648152 19:204504-204526 ATTCCTTACAAACAAACAAAAGG - Intergenic
1164546999 19:29174167-29174189 CTTACTTTCTCACAAACAAAAGG - Intergenic
1165046727 19:33110645-33110667 TTTGCTTTAAAAAAAAAAAACGG + Intronic
1167582034 19:50350715-50350737 TTTACTTTCTCCCAAACAAAGGG + Intronic
1168655188 19:58122433-58122455 ATTCCATTCATACAAACACATGG + Intergenic
1168672474 19:58251170-58251192 ATTGCTTTCTTCTAAACAAATGG - Intronic
925219596 2:2127363-2127385 TTTATTTAAATACAAACAAAAGG + Intronic
925386251 2:3463799-3463821 TTTGGTTTCAAGTAAACAAAAGG - Intronic
925612559 2:5714320-5714342 TTTACTTTCATGTAAACGAAAGG - Intergenic
926182333 2:10656113-10656135 CTGGCTTTCATCCAACCAAAGGG - Intronic
926208379 2:10850103-10850125 TTTCCTTTCACAATAACAAAAGG - Intronic
927017904 2:18986016-18986038 TTTTCTTTTAAACTAACAAATGG + Intergenic
928143937 2:28754278-28754300 TTTGAATTCACAAAAACAAATGG - Intronic
928293677 2:30061944-30061966 TTTACTTTCTCCCAAACAAATGG - Intergenic
928459007 2:31451817-31451839 TTTACTTTCTCCCAAACAAATGG - Intergenic
928866562 2:35923979-35924001 TTTGCTTACTTACAAATAACTGG - Intergenic
929529171 2:42736264-42736286 TTTACTTTCACTCAAACAAATGG + Intronic
929729727 2:44475196-44475218 TAGGCTTTAATAAAAACAAATGG + Intronic
929973880 2:46611965-46611987 TTTTTTTTTAAACAAACAAAAGG + Intronic
930042935 2:47142718-47142740 TTTGTTTTCATGTATACAAATGG + Intronic
930373499 2:50534693-50534715 TTTGGTTTCATATAGATAAAAGG + Intronic
931572381 2:63681849-63681871 TTTACTTTCTCTCAAACAAAGGG - Intronic
931590543 2:63878441-63878463 TTTGCTTTCACACTTAAAAAAGG + Intronic
935454854 2:103255699-103255721 TTTCCTTACATACAAAATAATGG - Intergenic
936660782 2:114541293-114541315 TCTACTTTCATACAAACCACTGG - Intronic
936925456 2:117731755-117731777 TTTGCTTCCTCTCAAACAAATGG - Intergenic
937816055 2:126251844-126251866 TTTGCTTTGAGGAAAACAAAAGG - Intergenic
938766600 2:134464084-134464106 TTTGGTTTCATATGAACTAAAGG + Intronic
938978156 2:136499481-136499503 TTTGGTTTCATCTTAACAAAGGG - Intergenic
939265127 2:139862961-139862983 TTTGGTTATATACAAAGAAATGG - Intergenic
939273710 2:139971787-139971809 CTTGCTTTCTTCCGAACAAATGG - Intergenic
939383563 2:141466810-141466832 TTTTCTTTCATATTAAAAAAAGG - Intronic
939532800 2:143385739-143385761 TTTCATCTAATACAAACAAACGG - Intronic
939748723 2:146013022-146013044 TTGTTTTTCAAACAAACAAAAGG + Intergenic
940136325 2:150440224-150440246 TTTTTTTTCATACAACCAGAAGG + Intergenic
940594451 2:155772036-155772058 TTTGCTTTAATCCAAAAAATTGG + Intergenic
940678730 2:156756882-156756904 TTTGCTTTCTTGTAAGCAAATGG - Intergenic
941138364 2:161745909-161745931 CTTACTTTCCCACAAACAAATGG + Intronic
941366312 2:164615887-164615909 TTTGCTTTCCTTCAAACAATAGG + Intronic
941837824 2:170045626-170045648 TTTGCTTTGTTATAAACCAAGGG + Intronic
942824000 2:180151934-180151956 TATGTTTGCATACAAACATATGG - Intergenic
943208084 2:184927326-184927348 CTTACTTTCTTCCAAACAAATGG + Intronic
943946044 2:194065859-194065881 TTTGCTATGATACAAGAAAAGGG - Intergenic
943973086 2:194436608-194436630 TTTGGATTCATAGAAACAGATGG - Intergenic
944189963 2:196992289-196992311 TTTGTTTTCATACCAGAAAAAGG - Intronic
944207213 2:197169298-197169320 TGTGCTATGATACTAACAAAAGG - Intronic
944293251 2:198032441-198032463 TTGGCTTTCATGAAGACAAAAGG + Intronic
944757508 2:202778897-202778919 TTTTCATTCATACAAAATAATGG - Exonic
945210350 2:207375895-207375917 CTTACTTTCTTCCAAACAAATGG - Intergenic
945351212 2:208783019-208783041 TTTTATCTCATACAAATAAAAGG + Intronic
946580342 2:221121457-221121479 TTTTCTTTCACCCATACAAAGGG + Intergenic
947313892 2:228833699-228833721 TTTTCTTTCATAAAAATAATAGG + Intergenic
947971514 2:234328975-234328997 TGTGCTTTCACACAAACAGAGGG - Intergenic
948356046 2:237378177-237378199 TTTGTTATAAAACAAACAAAGGG - Intronic
948444717 2:238023302-238023324 TGTGCTTTTCTACAAATAAATGG - Intronic
948966649 2:241386742-241386764 TTTGTTATCTTACAAACAGAGGG + Intronic
1168741951 20:199721-199743 CTTGCTTTCTCCCAAACAAACGG + Intergenic
1168805658 20:670971-670993 TTTCCTTTCATAATATCAAACGG - Intronic
1169037679 20:2467124-2467146 TTGGCATTTATACAAACAATTGG - Intronic
1169493899 20:6094796-6094818 TTTGCCATCAGACAAACAATGGG - Intronic
1169525202 20:6416947-6416969 TTTGCTTTAAAAAAAAAAAAAGG - Intergenic
1170066597 20:12317308-12317330 TTTGCTTTCATGCAAGAAAGTGG + Intergenic
1170709135 20:18774703-18774725 TTTGCTTTCCCCTAAACAAATGG + Intergenic
1171117501 20:22537814-22537836 TTTGCTGTAAAACAAGCAAAAGG + Intergenic
1171418825 20:25003187-25003209 TTGGCTGTCAAACTAACAAATGG - Intergenic
1171724915 20:28607630-28607652 TTTCTTTTCATCCAAACAACTGG - Intergenic
1171789104 20:29502137-29502159 TTTCTTTTCATCCAAACAACTGG - Intergenic
1171938094 20:31294645-31294667 TTTACTTTCTCCCAAACAAATGG - Intergenic
1173060941 20:39660576-39660598 TTTCCTTGCATACAAACCAAGGG - Intergenic
1173204100 20:40979254-40979276 CTTACTTTCTTCCAAACAAATGG + Intergenic
1173997380 20:47348825-47348847 TCTGCTTTCATAGATGCAAATGG + Intronic
1174457357 20:50659116-50659138 TTTTCTTTCATACCAGGAAAAGG - Intronic
1174566249 20:51466493-51466515 TTTGCTTTCAGGAAAAAAAAAGG + Intronic
1174938675 20:54899194-54899216 TTTACTTTCTCCCAAACAAATGG - Intergenic
1175632057 20:60549740-60549762 CTTACTTTCTTTCAAACAAACGG + Intergenic
1176632767 21:9155017-9155039 TGTGCTTACATACATAGAAAAGG - Intergenic
1176873633 21:14104366-14104388 TTTACTTTCTCCCAAACAAATGG + Intergenic
1177780400 21:25616099-25616121 TTGGCATTCAAACAAGCAAATGG + Intergenic
1178208746 21:30502351-30502373 TTTGCTTTTATGAAAAGAAAGGG + Intergenic
1179523687 21:41961771-41961793 TTTGCCATAATACTAACAAAAGG - Intergenic
1179652619 21:42821425-42821447 TTTACTTTCTCCCAAACAAATGG - Intergenic
1180298465 22:10966322-10966344 TTTCTTTTCATCCAAACAACTGG - Intergenic
1180409947 22:12597485-12597507 TTTCTTTTCATCCAAACAACTGG + Intergenic
1181677910 22:24469465-24469487 TTTCTTTTCATACAAATGAAAGG + Intergenic
1182208567 22:28653645-28653667 GTTTCTTTCAGAAAAACAAATGG - Intronic
951420466 3:22478192-22478214 TTTGCTTTCACAGAGATAAAAGG + Intergenic
951598046 3:24339587-24339609 TTTGCTATAATACAAACATGCGG + Intronic
952066329 3:29576298-29576320 TTTACTTTCTCCCAAACAAATGG + Intronic
952676072 3:36031601-36031623 ATTGCTTTAAAAAAAACAAAAGG - Intergenic
952984675 3:38768453-38768475 GTTTTTTTCAGACAAACAAATGG - Intronic
954561405 3:51559810-51559832 TTGGCTCTCATACAGACAACCGG - Intronic
954847954 3:53576292-53576314 TTTGCTTTCTTAAAACAAAATGG + Intronic
955057412 3:55468969-55468991 TTTCCTGTCCTACAACCAAAGGG + Exonic
955659403 3:61280585-61280607 CCTGCTTTCAGACAAACAGAGGG - Intergenic
955728399 3:61957884-61957906 TCTGCTTTCAGACTAAGAAAGGG - Intronic
956561766 3:70586056-70586078 TTGCCTTTTATACACACAAATGG - Intergenic
956888852 3:73589412-73589434 TTAACTTTCAAACAAACTAAAGG + Intronic
957280836 3:78149447-78149469 TTTGCTTACATATAAACCCAGGG - Intergenic
957407653 3:79791923-79791945 TTTCCTTTCATAGAAAAAGAAGG - Intergenic
957437599 3:80199094-80199116 TTTGCTTACATACTAACTTAGGG - Intergenic
958129715 3:89402528-89402550 TTTGATTTAATAAAAACAATAGG - Intronic
958599540 3:96277471-96277493 TTTTCTTTTATTAAAACAAATGG + Intergenic
959310622 3:104731205-104731227 TTTAATTTCATTCAAACATAGGG + Intergenic
959880262 3:111436997-111437019 TTTGTTTTCATAGAAATAAAAGG - Intronic
962176627 3:133162154-133162176 TTTTTTTTCATATATACAAAAGG + Intronic
963179555 3:142339243-142339265 TTTACTTTCTCCCAAACAAATGG - Intronic
963823044 3:149920843-149920865 TTTGCTTGCAAAAATACAAATGG - Intronic
964018740 3:151980721-151980743 TTTGCTGTCATATAAAAAAGAGG + Intergenic
964141511 3:153406555-153406577 TTTGCTTTAACATTAACAAAAGG - Intergenic
964372699 3:156017678-156017700 TTTGGTTACATCCAAATAAAAGG - Intergenic
964420836 3:156501184-156501206 TTTACCTCCATAGAAACAAAAGG + Intronic
965118209 3:164519436-164519458 CTTACTTTCTTCCAAACAAATGG + Intergenic
965257080 3:166426504-166426526 CTTACTTTCTTCCAAACAAATGG - Intergenic
965698982 3:171440056-171440078 TTGGCTATCATAAAAACAGAGGG - Intronic
966151799 3:176874292-176874314 TTTACTTTCTCCCAAACAAATGG - Intergenic
967462930 3:189767104-189767126 TTTGCTTTCATACAAACAAAAGG + Intronic
967668760 3:192206748-192206770 CTTGCTGTCATTGAAACAAATGG + Intronic
967791080 3:193549915-193549937 TTTGCCATGATGCAAACAAACGG + Intronic
968369695 3:198215611-198215633 ATTCCTTACAAACAAACAAAAGG + Intergenic
968429023 4:544409-544431 CTTACTTTCTTCCAAACAAATGG + Intergenic
968567494 4:1321889-1321911 TTTGCTTTCATATAAATCATTGG + Intronic
970196828 4:13559460-13559482 TGTGCTTTCAAAAAAAAAAAAGG + Intergenic
970549647 4:17166559-17166581 TTGGCTTTCATAAGAAGAAAAGG + Intergenic
971526591 4:27626824-27626846 TTTGCTTTCAAATACACACAGGG - Intergenic
971625464 4:28914815-28914837 TTTGGTTGCATGCAACCAAATGG - Intergenic
971690447 4:29827452-29827474 TTTACTTTCTTCCAAACAAATGG - Intergenic
972522764 4:39876604-39876626 TTTGCTATCCTACCAAAAAATGG - Intronic
972814795 4:42632138-42632160 TGTGCTTTCATACATAGAAAAGG - Intronic
972902631 4:43703455-43703477 TTTGCTTTCTTTCAAACAAATGG + Intergenic
972970507 4:44569174-44569196 TTTGCAAACAAACAAACAAAAGG - Intergenic
973602384 4:52554852-52554874 TTTATTTTCATAAAAACAAATGG - Intergenic
973751954 4:54030086-54030108 TTTGTATGCATACAAATAAATGG - Intronic
974017993 4:56666675-56666697 TCTACTTTCATAGAAATAAATGG + Intronic
975039497 4:69727302-69727324 TTTGAATTCATTCAAATAAAAGG - Intronic
975063366 4:70033149-70033171 TTTTCCTGCATACACACAAAAGG - Exonic
975065310 4:70055480-70055502 TTTTCCTGCATACACACAAAAGG - Exonic
975335588 4:73171231-73171253 TTTTCTTTCTCCCAAACAAATGG - Intronic
975812913 4:78188130-78188152 TTTGTTTCCATAGAAAGAAAGGG - Intronic
976062421 4:81144518-81144540 TTTGATTTTATAAAAGCAAAGGG + Intronic
976722176 4:88179212-88179234 TTTACTTTCTCCCAAACAAATGG - Intronic
976832305 4:89329466-89329488 TTTACTTTCACATAAACCAAAGG + Intergenic
977216550 4:94291868-94291890 TTTGCTTCTATACAAAGAGAGGG - Intergenic
977300554 4:95262228-95262250 TTTGCTTTCATCAAAACTGAAGG + Intronic
977363041 4:96030712-96030734 TTTGATTTCTGACAAATAAATGG - Intergenic
977791745 4:101113051-101113073 TTTGCTTTGATGGAAACCAAAGG + Intronic
978309101 4:107365973-107365995 TTTGCTTAAAAAAAAACAAATGG + Intergenic
978554309 4:109962008-109962030 TATGTTTTCAAACAAACAAAAGG - Intronic
978942859 4:114458291-114458313 TTTGTATACATATAAACAAAAGG + Intergenic
979000776 4:115216015-115216037 TTTGCTTTGAGTCAAATAAAAGG + Intergenic
979258407 4:118627588-118627610 ATTCCTTACAAACAAACAAAAGG + Intergenic
979329944 4:119412971-119412993 ATTCCTTACAAACAAACAAAAGG - Intergenic
979997680 4:127451905-127451927 TTTGGTGTCATATAAGCAAATGG - Intergenic
980197300 4:129606589-129606611 TTTGGTTACATATAAATAAATGG + Intergenic
980745745 4:137012312-137012334 TTTGCTTTCTTAAAAAATAAAGG - Intergenic
981902174 4:149879501-149879523 TTTTTTTTCAGACAAACAAGAGG - Intergenic
982044221 4:151426085-151426107 TTTGCTTTTAAAAAAACAAGCGG + Intronic
982198964 4:152941485-152941507 TTTATTTTTATACAAACCAATGG + Intronic
982412945 4:155099550-155099572 TTTGATTTCAAACAACCCAAAGG - Intergenic
982432357 4:155337676-155337698 TTTACTTTTATATAAAGAAAAGG - Intergenic
983115942 4:163816423-163816445 TTTACCTTCATACATACAAGGGG + Intronic
983586513 4:169361373-169361395 CTTACTTTCTTCCAAACAAATGG + Intergenic
984683834 4:182643633-182643655 TCTCTTTTAATACAAACAAAAGG + Intronic
985229608 4:187800049-187800071 CTTACTTTCTCACAAACAAATGG - Intergenic
985436559 4:189936080-189936102 TTTCTTTTCATCCAAACAACTGG + Intergenic
986526201 5:8679911-8679933 TTTGCTTAGACACAAAGAAAAGG + Intergenic
987018769 5:13848262-13848284 TTTGCTTTAAAGTAAACAAAGGG + Intronic
987108519 5:14664074-14664096 TTTGATTTAAGAGAAACAAAAGG - Intergenic
988610605 5:32721000-32721022 CTTGCCTTTATACAATCAAAAGG - Intronic
989502487 5:42184704-42184726 TTTGTTTTAATACAAATAAATGG + Intergenic
989750398 5:44885619-44885641 TTTTGCTTCAAACAAACAAAAGG - Intergenic
990112255 5:52341569-52341591 TGTGCTTTCATCACAACAAATGG + Intergenic
990246206 5:53865676-53865698 TTTGCTTACATACCAAATAATGG + Intergenic
990304846 5:54483801-54483823 CTTGCTTTCAAAAAAATAAAAGG - Intergenic
990828049 5:59923526-59923548 TTTACTTTCTACCAAACAAATGG - Intronic
991152316 5:63384794-63384816 TTTACTTTCAAAGGAACAAAGGG + Intergenic
991234918 5:64382663-64382685 TTTCCTGTCATAGAAAGAAAAGG - Intergenic
991447455 5:66715478-66715500 TTTACTTTAATACCAAAAAATGG + Intronic
991513371 5:67405546-67405568 TTTTCTTTGTTAAAAACAAAAGG - Intergenic
992042743 5:72851880-72851902 TTTGCTTTCATGCATATAGATGG + Intronic
992291502 5:75284059-75284081 TTTACTTTCCCCCAAACAAATGG - Intergenic
992430937 5:76711308-76711330 TTTGCTTTAAAACTGACAAAGGG + Intergenic
992850677 5:80804612-80804634 TTTACTTTCCCCCAAACAAACGG + Intronic
993861845 5:93145767-93145789 TTTTCATTCCTACAAATAAAAGG + Intergenic
994907182 5:105856162-105856184 TCTGCTTTCCAAAAAACAAATGG + Intergenic
995028662 5:107454117-107454139 ATTGCTTTTATACAATCTAAAGG + Intronic
996220459 5:120925797-120925819 TTTGGTTTCTTAAAAAAAAAGGG + Intergenic
996922288 5:128782893-128782915 TTTGCTTACAAACAGACACAGGG + Intronic
999023722 5:148200922-148200944 TTTGTTTTAATACAACCTAAAGG - Intergenic
1000862385 5:166472055-166472077 TTTGTTTTCTTAGAGACAAAGGG + Intergenic
1001364114 5:171120144-171120166 CTTACTTTCTTCCAAACAAATGG + Intronic
1001786124 5:174415199-174415221 ATTGCTTTCAGAAAAAAAAATGG + Intergenic
1002728973 5:181321196-181321218 ATTCCTTACAAACAAACAAAAGG + Intergenic
1003048644 6:2760743-2760765 ATTTCTTTCATACCAATAAAGGG + Intergenic
1003501072 6:6703304-6703326 TCAGATTTCTTACAAACAAAGGG - Intergenic
1004181416 6:13383664-13383686 TTTGCTTACATAGAAACCCAAGG - Intronic
1004969504 6:20893306-20893328 TTTGCTTTGAGGCAAGCAAAAGG - Intronic
1005156962 6:22818659-22818681 CTTACTTTCACCCAAACAAATGG + Intergenic
1005280047 6:24263035-24263057 CTTGCCTTCCTGCAAACAAATGG - Intronic
1006972711 6:38063077-38063099 TTAGCTTTCAAAGAAAAAAAAGG - Intronic
1007021932 6:38529260-38529282 TTTTCTTTCCCCCAAACAAATGG - Intronic
1008922222 6:56854243-56854265 TTTGCTTTTCTTAAAACAAAAGG - Intronic
1009552525 6:65117370-65117392 TTTGCTGTCATAGACATAAAGGG + Intronic
1009642350 6:66354318-66354340 TCTGCTTTAATATAAATAAATGG + Intergenic
1009666768 6:66691645-66691667 GCTGCTTTCATACAACCAGAAGG - Intergenic
1009978404 6:70699233-70699255 CTTACTTTCCTGCAAACAAATGG + Intronic
1011019076 6:82790070-82790092 CTTCCTTTCACCCAAACAAATGG - Intergenic
1011739207 6:90342588-90342610 TTTGCTCTCATGCAAACATGAGG + Intergenic
1011855968 6:91691797-91691819 TTTGCCTTCTTTCAAACAAAAGG - Intergenic
1011988792 6:93485750-93485772 TCTTCTTGCATACAAACATAAGG + Intergenic
1012178107 6:96114838-96114860 CTTGCTTTCATCCAAGGAAAAGG - Intronic
1013904054 6:115193955-115193977 TTTGTTTTCATTTAAAAAAAAGG + Intergenic
1014444544 6:121512348-121512370 TTTGTTTCCATTCAAACACAGGG - Intergenic
1014972253 6:127831635-127831657 TTTTTACTCATACAAACAAAAGG + Intronic
1014983381 6:127972932-127972954 TTTGACTTCATACACACATAGGG - Intronic
1015825032 6:137302224-137302246 TTTGCTTACATAGAAACCCAAGG - Intergenic
1016560159 6:145387665-145387687 TTTGCTTTCATAGTAACAGCAGG + Intergenic
1016612653 6:146009922-146009944 TCTGCTTTCTTACAAACCAGAGG + Intergenic
1016666328 6:146646039-146646061 TTACATTTCATACAAATAAAGGG + Intronic
1016915063 6:149237214-149237236 TTTAGTTTCAAAGAAACAAAAGG - Intronic
1017316756 6:153039905-153039927 TTTTCTTTCTTATAAAGAAAAGG + Intronic
1017385513 6:153878346-153878368 TTTAATTTCATGCAAACTAAGGG + Intergenic
1018415420 6:163598006-163598028 TCTACTTTCTTACAAACAGATGG - Intergenic
1019195420 6:170279129-170279151 TGTGCTTTAAAAAAAACAAAAGG + Intergenic
1019448320 7:1082871-1082893 TTTGCATTTATCCAAAGAAAGGG + Intronic
1020944123 7:14579417-14579439 TTTGCTTCCAGATTAACAAATGG - Intronic
1020999161 7:15306258-15306280 TTTTATTTCATACTAATAAATGG + Intronic
1021227453 7:18044899-18044921 TTTGTTCTAATGCAAACAAATGG - Intergenic
1021884761 7:25128040-25128062 CTTACTTTCACCCAAACAAATGG + Intergenic
1022622357 7:31997793-31997815 TTTTCTTTGAGACAAAGAAATGG - Intronic
1022683699 7:32574885-32574907 TTTCCTTTCCTAGCAACAAAAGG + Intronic
1023400387 7:39788893-39788915 ATTCCTTACAAACAAACAAAAGG + Intergenic
1023913733 7:44573336-44573358 TTTTCTTTCTTACATAAAAAGGG - Intronic
1024073319 7:45804640-45804662 ATTCCTTACAAACAAACAAAAGG + Intergenic
1024418480 7:49135519-49135541 TTGGCTTTTATAAAAACAAAGGG - Intergenic
1024650012 7:51395543-51395565 TTTCCTTACAAACAAACAAAAGG - Intergenic
1025132209 7:56381368-56381390 ATTCCTTACAAACAAACAAAAGG - Intergenic
1026194493 7:68161365-68161387 TTTGGTTTCATGCACAGAAAAGG + Intergenic
1026700469 7:72638296-72638318 TTTGTTTGCTTACATACAAATGG - Intronic
1027132097 7:75598436-75598458 TTTGCTTTCATGCTCAGAAAAGG + Intronic
1027537877 7:79429188-79429210 TTTGATTTTATTCAAATAAATGG - Intronic
1027995144 7:85416479-85416501 TTTGCTTTCATTGAAAGAAGAGG - Intergenic
1028517527 7:91694998-91695020 TTGGCTTTCATCAAAAGAAAAGG + Intronic
1028890623 7:95984212-95984234 TCTGCTTTTAAACAAACACATGG - Intronic
1030065794 7:105657888-105657910 TTAGGTTTCATAAAAACTAAAGG - Intronic
1030391749 7:108937114-108937136 TGTTCTCTCATGCAAACAAAAGG + Intergenic
1030444489 7:109632309-109632331 TTTCCTTTCAAACCAACACAAGG - Intergenic
1030838501 7:114318844-114318866 TTGGCTTACATACATACAACTGG - Intronic
1030996286 7:116362179-116362201 TTTTCTTTCTTACAAGCTAAGGG + Intronic
1031387131 7:121164745-121164767 TTTCCTATCAGACAAATAAATGG - Intronic
1031425303 7:121598020-121598042 TTTGCTTTAACACAAAAATAAGG + Intergenic
1031546054 7:123052841-123052863 TTTCCTTTCTCCCAAACAAATGG + Intergenic
1031734745 7:125344017-125344039 TTTACTTTCATAAATACACAGGG + Intergenic
1032050710 7:128648337-128648359 ATTCCTTACAAACAAACAAAAGG + Intergenic
1032138669 7:129306929-129306951 CTTACTTTCTTCCAAACAAACGG + Intronic
1032543092 7:132720504-132720526 TTTGCTTTCTAACAAGCATATGG + Intronic
1033007365 7:137581378-137581400 GTTTCTTTTATACAAACAGAGGG + Intronic
1034693206 7:153030525-153030547 TTTGCTTTCACAAGAACAAAGGG - Intergenic
1037171486 8:15898164-15898186 TTTCGTTTCATGAAAACAAATGG + Intergenic
1037354026 8:17998495-17998517 TTTACTTTCTTTCAAATAAATGG + Intronic
1038094901 8:24297448-24297470 TCTGCTTTTATACAAAAAATCGG + Intronic
1038579468 8:28735130-28735152 TTTCCTTTCATAAAAACAAGTGG - Intronic
1038788360 8:30643282-30643304 TTTGCTTTAAAACAACCAATGGG + Intronic
1039118539 8:34119463-34119485 TTTGCTTTCATAGAAATACTAGG - Intergenic
1039169421 8:34725556-34725578 TATTCTCTGATACAAACAAATGG - Intergenic
1041119359 8:54570665-54570687 TTTGTTTTCAAACAAACACACGG + Intergenic
1041489741 8:58420158-58420180 TTTGTTTTCATATAAGAAAATGG + Intronic
1042898488 8:73696082-73696104 TTTACTTTCTCCCAAACAAATGG - Intronic
1043015849 8:74940081-74940103 CTTACTTTCTCACAAACAAATGG + Intergenic
1043740083 8:83800872-83800894 CTTGCTTTCTTCGAAACAAATGG + Intergenic
1043941719 8:86203752-86203774 ATTGATTTTATACAAATAAAAGG - Intergenic
1044034241 8:87278565-87278587 TTTGCCTTCATTCAAAAAGATGG - Intronic
1045216106 8:100150095-100150117 TTTGCTTTAAAACAAGTAAACGG + Intergenic
1046412577 8:113866109-113866131 TTTTTTTTCATACAGAGAAAAGG + Intergenic
1047118412 8:121871509-121871531 TTGGATTTTATAGAAACAAAGGG - Intergenic
1047138235 8:122106386-122106408 CTTACTTTCCTCCAAACAAATGG + Intergenic
1047173667 8:122519891-122519913 CTTTATTTCAGACAAACAAAGGG + Intergenic
1047948380 8:129905943-129905965 CTTGCCTCCATACAAACAAATGG + Intronic
1048158823 8:131992242-131992264 TATGCTTTGATACAAATAACTGG - Intronic
1048646770 8:136429098-136429120 TTTACTTTCTCCCAAACAAATGG - Intergenic
1050439130 9:5642218-5642240 GTTACTTTCTTCCAAACAAATGG + Intronic
1050542849 9:6684900-6684922 TTTGTTTGCTTACAAAAAAAGGG + Intergenic
1050578635 9:7027416-7027438 CTTACTTTCTTCCAAACAAAGGG + Intronic
1051435425 9:17025790-17025812 TTTGCTTTTATATAAAAAATTGG + Intergenic
1052547923 9:29904154-29904176 TTTGATTTCATACAGACTCAGGG + Intergenic
1052602667 9:30656453-30656475 TTTGCTTTAATATTAACAAAAGG + Intergenic
1052728535 9:32259265-32259287 TTTGCTTTCTTACAAGTACAGGG + Intergenic
1053237802 9:36471291-36471313 TTTTCTTCCATAGAAACAAGAGG + Intronic
1053724687 9:40987551-40987573 TTTCTTTTCATCCAAACAACTGG + Intergenic
1054341283 9:63864448-63864470 TTTCTTTTCATCCAAACAACTGG - Intergenic
1054909174 9:70438260-70438282 TATGCTTTAATCCAAAGAAATGG - Intergenic
1055008469 9:71536538-71536560 TTTGTGTTCATACAAACACTGGG - Intergenic
1055227471 9:74016025-74016047 TTTACTTTCTCCCAAACAAATGG - Intergenic
1056187750 9:84152471-84152493 TTTGCTCTCATAGAAACCAGTGG - Intergenic
1056424563 9:86464298-86464320 TTTCCTTTCTCCCAAACAAATGG + Intergenic
1056440938 9:86620568-86620590 TTTACATTCCTACAAACAACTGG + Intergenic
1057923100 9:99115572-99115594 TGTGCTTGCATACAAATGAAAGG - Intronic
1058248959 9:102668219-102668241 CTTACTTTCTTCCAAACAAATGG + Intergenic
1059203161 9:112437679-112437701 TTTCCTTTCACATAAACATATGG - Intronic
1059634421 9:116157356-116157378 TTTCCTTTCAGAAAAATAAAAGG - Intronic
1059752547 9:117261823-117261845 TTTGCTTTGAGAAAAGCAAAAGG - Intronic
1060625071 9:125104744-125104766 TTTGTTTTTTGACAAACAAAGGG - Intronic
1061589424 9:131589047-131589069 TTTGCCTTGAGACACACAAAGGG + Intronic
1203450121 Un_GL000219v1:104445-104467 TTTCTTTTCATCCAAACAACTGG - Intergenic
1203576554 Un_KI270745v1:13074-13096 ATTCCTTACAAACAAACAAAAGG + Intergenic
1186855340 X:13621048-13621070 CTTGCTTTCATACATAAAATTGG + Intronic
1187187340 X:16999737-16999759 TTTGCTTTTTTAAAAAGAAAAGG - Intronic
1188806456 X:34596469-34596491 TTTGCATTCATAAAAAAGAATGG - Intergenic
1189019710 X:37321151-37321173 CTTGCTTTCTTTCAAACAAATGG - Intergenic
1189449568 X:41115762-41115784 TTTCTTTTCATCCAAAAAAAAGG - Intronic
1189684942 X:43554223-43554245 CTTGCTTCCAAACAACCAAAAGG - Intergenic
1189875564 X:45433096-45433118 CTTACTTTCCTTCAAACAAATGG + Intergenic
1190464691 X:50714310-50714332 TTTGCTTTCATACAAACTTTAGG + Intronic
1191197290 X:57737779-57737801 CTTACTTTCTTACAAAAAAATGG - Intergenic
1191749412 X:64525490-64525512 TTAGAGATCATACAAACAAATGG + Intergenic
1191986265 X:66984843-66984865 CTTACTTTCTTCCAAACAAATGG + Intergenic
1192593432 X:72381684-72381706 TTTCCTATTATACAAACACAGGG - Intronic
1192771049 X:74191306-74191328 TTCAATTTCATACAAAGAAAAGG - Intergenic
1192841290 X:74858331-74858353 CTTACTTTCTTCCAAACAAATGG - Intronic
1192858386 X:75039235-75039257 TTTCCTTTTCTGCAAACAAATGG + Intergenic
1192940982 X:75911693-75911715 CCTGCTTTCATCCAAACAAATGG + Intergenic
1193098450 X:77579458-77579480 TTTACTTTCTCCCAAACAAATGG - Intronic
1193215708 X:78861309-78861331 TTTGCTTTCTCACAAAGAAATGG - Intergenic
1193596319 X:83450891-83450913 TTTACTTTCTTCCACACAAAGGG + Intergenic
1193641621 X:84015632-84015654 AGAGCTTTCATATAAACAAAAGG - Intergenic
1194006811 X:88504700-88504722 CTTACTTTCCTCCAAACAAATGG - Intergenic
1194023630 X:88724287-88724309 CTTCCTTTCTTCCAAACAAATGG - Intergenic
1194121818 X:89971852-89971874 TTTGCTTTCACAGAAGCAATAGG - Intergenic
1194370992 X:93071184-93071206 CTTTCTTTCACCCAAACAAATGG - Intergenic
1194787511 X:98105642-98105664 CTTACTTTCTTCCAAACAAATGG + Intergenic
1195431574 X:104795357-104795379 TTTTCCTTCATGAAAACAAATGG - Intronic
1195642033 X:107186397-107186419 TTTGCTGTTACACAAAAAAATGG - Intronic
1196200807 X:112883949-112883971 TTTTCTAGCATACAAATAAATGG + Intergenic
1196465005 X:115962344-115962366 GTCGTTTTCAGACAAACAAATGG + Intergenic
1196518531 X:116643470-116643492 TTTGTTTTCATAGAAGCAGAAGG - Intergenic
1196537251 X:116862110-116862132 CTTACTTTCTTCCAAACAAATGG + Intergenic
1196619729 X:117807790-117807812 CTTACTTTCTTCCAAACAAATGG - Intergenic
1198621507 X:138516897-138516919 TTTGCCTTAATAAAAATAAATGG + Intergenic
1199103055 X:143828387-143828409 TTTGCTTTCATAGAATTGAAGGG - Intergenic
1199406988 X:147473923-147473945 TTTGTTTTAATAGAGACAAAGGG - Intergenic
1199442947 X:147889400-147889422 TTTACTTTCTCCCAAACAAATGG + Intergenic
1199840967 X:151648534-151648556 TTTTCTATCATACAATAAAAAGG - Intronic
1200474671 Y:3629289-3629311 TTTGCTTTCACAGAAGCAATAGG - Intergenic
1200678787 Y:6183080-6183102 CTTTCTTTCACCCAAACAAATGG - Intergenic
1200786120 Y:7261959-7261981 TTTGATTTAATAAAATCAAATGG - Intergenic
1202029763 Y:20559342-20559364 TGTGGTTTCCTAGAAACAAAGGG - Intergenic
1202099342 Y:21289460-21289482 TTTTCTTTATTCCAAACAAATGG + Intergenic