ID: 967465943

View in Genome Browser
Species Human (GRCh38)
Location 3:189806251-189806273
Sequence CTGTGTAGCTAGAAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 2, 2: 9, 3: 91, 4: 372}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967465932_967465943 30 Left 967465932 3:189806198-189806220 CCCATGCGTCTTTGTTCTCATCC 0: 1
1: 0
2: 0
3: 8
4: 161
Right 967465943 3:189806251-189806273 CTGTGTAGCTAGAAGCAGGAGGG 0: 1
1: 2
2: 9
3: 91
4: 372
967465933_967465943 29 Left 967465933 3:189806199-189806221 CCATGCGTCTTTGTTCTCATCCA 0: 1
1: 0
2: 1
3: 15
4: 216
Right 967465943 3:189806251-189806273 CTGTGTAGCTAGAAGCAGGAGGG 0: 1
1: 2
2: 9
3: 91
4: 372
967465939_967465943 3 Left 967465939 3:189806225-189806247 CCACAATTAGTTAGCTGGGGTTC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 967465943 3:189806251-189806273 CTGTGTAGCTAGAAGCAGGAGGG 0: 1
1: 2
2: 9
3: 91
4: 372
967465934_967465943 9 Left 967465934 3:189806219-189806241 CCAAGCCCACAATTAGTTAGCTG 0: 1
1: 0
2: 0
3: 4
4: 88
Right 967465943 3:189806251-189806273 CTGTGTAGCTAGAAGCAGGAGGG 0: 1
1: 2
2: 9
3: 91
4: 372
967465938_967465943 4 Left 967465938 3:189806224-189806246 CCCACAATTAGTTAGCTGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 70
Right 967465943 3:189806251-189806273 CTGTGTAGCTAGAAGCAGGAGGG 0: 1
1: 2
2: 9
3: 91
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967465943 Original CRISPR CTGTGTAGCTAGAAGCAGGA GGG Intronic
900105880 1:980826-980848 CTGGGCAGCTAGCTGCAGGAGGG - Exonic
900159255 1:1215777-1215799 CTGGGCAGCTTCAAGCAGGAGGG - Intergenic
901383590 1:8891598-8891620 CTGTGAGGCTCGAAGCAAGATGG + Intergenic
902453838 1:16517153-16517175 CTGTGAGGCTAGAACCAAGATGG + Intergenic
902498641 1:16893100-16893122 CTGTGAGGCTAGAACCAAGATGG - Intronic
902593355 1:17490867-17490889 CTCTGAGGCTAGAAGCAAGATGG - Intergenic
903699084 1:25232829-25232851 CTGCGAGGCTAGAAGCAAGATGG - Intergenic
903998475 1:27323045-27323067 CTGTCAAGGTTGAAGCAGGAGGG - Intronic
905641924 1:39595969-39595991 CAGTGTAGCTAGAGCCAGGGAGG - Intergenic
905792012 1:40794849-40794871 CTGTGGAGCCAGAAGAGGGAGGG + Intronic
906100606 1:43257953-43257975 CTGTGCACCTGGAAGCAGGAGGG + Intronic
906984986 1:50673428-50673450 CTGAGTACCTAATAGCAGGAAGG + Intronic
907190659 1:52645238-52645260 CTGAGCAGCAAAAAGCAGGAGGG + Intronic
907424893 1:54373358-54373380 CTCTGTAACTAGAATCATGAAGG - Intronic
909508145 1:76418367-76418389 CAGTGTAGCTTGAAGGTGGAGGG + Intronic
910689618 1:89952792-89952814 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
910916589 1:92296243-92296265 GTGTGTACCTAGAAGGAAGATGG + Intronic
911432824 1:97814129-97814151 CTGAATAGCAAGAAGCAGCAAGG + Intronic
912460985 1:109831365-109831387 CTTTGAGGCTAGAAGCAAGATGG - Intergenic
912524077 1:110267759-110267781 CTGTGAGGTTAGAAGCAAGATGG - Intronic
912537254 1:110383927-110383949 CTTGGAAGTTAGAAGCAGGATGG + Intronic
913976796 1:143465422-143465444 TTATGTACCTAGAAGCAGAAAGG + Intergenic
914005969 1:143732494-143732516 CTGTGAGGCTAGAACCAAGATGG + Intergenic
914071198 1:144291049-144291071 TTATGTACCTAGAAGCAGAAAGG + Intergenic
914107957 1:144675306-144675328 TTATGTACCTAGAAGCAGAAAGG - Intergenic
915743620 1:158139440-158139462 CTGTGTCCCTAGTAGCATGAAGG + Intergenic
915993478 1:160540857-160540879 CTGAGAAGCTAGAGACAGGAAGG - Intergenic
916629284 1:166594299-166594321 CTGTGTTGTTAGAAGTAGCAAGG - Intergenic
916812420 1:168317147-168317169 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
916895892 1:169161625-169161647 CTGTGAGGCCAGAAGCAAGATGG - Intronic
917880492 1:179330661-179330683 CTGTGAGGCTAGAAGCATGATGG + Intronic
919545656 1:198914957-198914979 CAGGGTAGCTAGCAGTAGGAGGG - Intergenic
919832166 1:201549507-201549529 CTGTGTATTTAGAAGCCAGAAGG - Intergenic
920100075 1:203511783-203511805 CTGTTTACCAATAAGCAGGAAGG - Intergenic
920509095 1:206537472-206537494 CTTTATAACTAGAAGCAGGCAGG + Intronic
920997920 1:211013077-211013099 CTGTCCAGCTGGAAGCAGGTGGG - Intronic
921264967 1:213414778-213414800 ATGGGTAACTGGAAGCAGGAGGG + Intergenic
922334129 1:224605359-224605381 CTGTGGGGCTAGAAGCAAGATGG - Intronic
923876405 1:238053923-238053945 CTGTGAGGCTAGAAGCAAAATGG - Intergenic
924837831 1:247672249-247672271 ATGTATAGCTGGAAGCAGGGCGG + Exonic
1063155162 10:3372554-3372576 CTGTGAGGCTAGAATCAAGATGG + Intergenic
1064648242 10:17482094-17482116 CTGTGAGGCTAGAAGCAAGACGG + Intergenic
1065208003 10:23375306-23375328 CTGGGAAGCCAGAAGCAAGATGG + Intergenic
1065295079 10:24266588-24266610 CTCTGTAGCTAGCAAGAGGATGG + Intronic
1065971366 10:30808549-30808571 CTGTGCAGAAGGAAGCAGGATGG + Intergenic
1066061555 10:31727965-31727987 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1067916852 10:50408927-50408949 GTTTGTAGCCAGTAGCAGGAGGG - Intronic
1067961455 10:50856309-50856331 CTCTGTAGCCAAAATCAGGAGGG + Intronic
1068606064 10:59006270-59006292 CTGTGAAGCTGGAGGGAGGAAGG + Intergenic
1068653525 10:59550383-59550405 CTGTGAAGCTAGAAGCAAGACGG + Intergenic
1069136603 10:64773982-64774004 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1069685209 10:70313535-70313557 TTGTGAGGCTAGAAGCAAGATGG - Intronic
1069806450 10:71128161-71128183 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1070855518 10:79605410-79605432 CTGAGCAGCTAGCAGCAGCAAGG - Intergenic
1071054924 10:81498590-81498612 CTGTGGAGTTAGAAGCAAAACGG + Intergenic
1071880099 10:89888062-89888084 CTGTGATGCTAGAGGCAAGACGG - Intergenic
1071998275 10:91168291-91168313 CTGAGAAGAAAGAAGCAGGAGGG + Intronic
1072237898 10:93468980-93469002 CTGTGTAGCCAGAAAGAGGCAGG - Intronic
1072275750 10:93821007-93821029 CGGTGAGGCTAGAAGCAAGATGG + Intergenic
1074095328 10:110306375-110306397 GTGTGTAGCTAGAATTAAGAAGG + Intergenic
1074162656 10:110846893-110846915 ATGTGGAGCTGGAAGGAGGAAGG - Intergenic
1074515360 10:114163500-114163522 CTGGCTAGCTACAAGCAGTAGGG + Intronic
1076109814 10:127851728-127851750 TTCTGCAGCTAGAAGGAGGATGG + Intergenic
1076695453 10:132245188-132245210 CTGTACAGCCAGGAGCAGGAGGG + Intronic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1077694530 11:4382350-4382372 CTGTGAGGCTAGAAGCAAGTCGG + Intergenic
1077789960 11:5428676-5428698 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1078277093 11:9859801-9859823 CTGTGTAGTTAGAAGCTGGGTGG + Intronic
1078536118 11:12175850-12175872 CTATGTAGCTGGAAGGAGGCAGG + Intronic
1079248745 11:18772198-18772220 CTGTGTAGCAAGAGGCAAGCAGG - Intronic
1080250460 11:30227694-30227716 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1080517627 11:33039057-33039079 TTGTGTAGCTACAAACAGGATGG + Intergenic
1081542288 11:44044625-44044647 GTGTGTGGCAAGAAGAAGGAAGG + Intergenic
1082820038 11:57538505-57538527 CTGTGCACCTAGAAGAAAGAGGG + Intergenic
1084033019 11:66492199-66492221 CTCAGTGGCTGGAAGCAGGATGG + Intronic
1084268713 11:68017962-68017984 CTGTTTAGCAAGAAGCAGAGTGG - Intronic
1084497754 11:69514891-69514913 CTGTGAAGCAAGAAGCATCAGGG - Intergenic
1085363699 11:75917188-75917210 TTGTGAGGCTAGAAGCAAGATGG + Intronic
1085451100 11:76633949-76633971 CTCTGTAGCTAGAAAAAGGAAGG - Intergenic
1085489926 11:76906036-76906058 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1085755562 11:79198614-79198636 CGGTGTCTCTAGAAGCAGGCTGG - Intronic
1086414710 11:86577024-86577046 CTGTTGTGGTAGAAGCAGGATGG + Intronic
1087803484 11:102530352-102530374 CTATGTAGATAGACTCAGGAAGG - Intronic
1088101653 11:106162476-106162498 CTGTGAGGCTAGAAGCAAAATGG + Intergenic
1088140889 11:106614549-106614571 CTGTGAGGCTAGAAGCAGCCAGG + Intergenic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1089595848 11:119579632-119579654 CTGGGGGGCTAGAAGCAAGAGGG - Intergenic
1089667170 11:120027755-120027777 CTGTGGAGCTAAGAGCAGGTTGG - Intergenic
1089792472 11:120954705-120954727 CTGTGATGCTAGATGCTGGAGGG - Intronic
1089956647 11:122577315-122577337 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1090288340 11:125519675-125519697 CTGTGAGGCTAAAAGCAAGATGG - Intergenic
1091099233 11:132854876-132854898 CTGTGAGGCTAGAAGAAAGATGG - Intronic
1091099986 11:132863107-132863129 CCATGTAGCTACAGGCAGGAAGG - Intronic
1091099994 11:132863148-132863170 CAATGTAGCTACAGGCAGGAAGG - Intronic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1092204813 12:6608205-6608227 CTGTGGAGCTAGAAGAGGGAAGG - Intergenic
1092938145 12:13383166-13383188 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1098095051 12:66946001-66946023 CTGTGTAGCAGGAAGAAGGAAGG - Intergenic
1098221418 12:68273911-68273933 ATGTGTAGATAGAAGTAGGGGGG + Intronic
1098289606 12:68945335-68945357 CTGTGAGACTAGAAGCAAGATGG + Intronic
1098291874 12:68964276-68964298 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1098921392 12:76305426-76305448 CTGTGAGGCTAAAAGCAAGATGG - Intergenic
1099809944 12:87568133-87568155 CTGTGAGGCTAGAAGCAAGGTGG + Intergenic
1100284255 12:93149817-93149839 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1100426685 12:94494151-94494173 CCGTGAGGCTAGAAGCAAGATGG - Intergenic
1100773427 12:97948962-97948984 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1102511347 12:113417675-113417697 CAGTGAGGCTAGAAGCAGGCTGG + Intronic
1102511352 12:113417708-113417730 CAGTGAGGCTAGAAGCAGGCTGG + Intronic
1104694964 12:130856251-130856273 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1105222435 13:18344387-18344409 TTATGTACCTAGAAGCAGAAAGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105755099 13:23456726-23456748 CTGTGAAGCTGGGAGCAAGATGG + Intergenic
1105792041 13:23811343-23811365 CTGAGAGGTTAGAAGCAGGATGG - Intronic
1106612967 13:31301031-31301053 CTGTGAGACTAGAAGCAAGATGG + Intronic
1107233173 13:38136283-38136305 CTGTCTAGCTAGCAGCAGATGGG - Intergenic
1108315830 13:49236257-49236279 CTGTGAACCTAGAAGCAAGACGG + Intergenic
1109909871 13:68895347-68895369 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
1111028499 13:82566900-82566922 CTGTGAAGCTGGAAGTAAGATGG + Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111821611 13:93222950-93222972 CTGTGTAGCTCTAAGAAGGCAGG + Intergenic
1112345487 13:98585719-98585741 CTCTGTCCCTAGATGCAGGAGGG - Intergenic
1112508063 13:99987320-99987342 CTGTGTCCCAACAAGCAGGATGG + Intergenic
1112755366 13:102626505-102626527 GTGTGTACCTAGAGGTAGGATGG + Intronic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1114810465 14:25892938-25892960 CTCTGAGGCTAGAAGCAAGATGG + Intergenic
1115262865 14:31471371-31471393 CTGGGAAGCTAGAAACAAGATGG - Intergenic
1115820837 14:37211026-37211048 CTGAGAAGCTAGAAGCAAGATGG + Intronic
1116012951 14:39372171-39372193 CTGTGTAGGCAGAAACAGTAGGG + Intronic
1117496954 14:56314916-56314938 TTGTGAAGTTAGAAGCAAGATGG - Intergenic
1119372776 14:74161817-74161839 CTGTGCAGCGACAAGCAGGTTGG - Intronic
1119676960 14:76562944-76562966 CTGTGTAGGTACAGGCAGCACGG - Intergenic
1120597461 14:86458959-86458981 ATGTTTAGCCAGAAACAGGAAGG + Intergenic
1121519987 14:94579463-94579485 ATGTGATGGTAGAAGCAGGAAGG - Intronic
1121520076 14:94580135-94580157 CTGGGTATCCAGAAGCAGGCAGG - Intronic
1122482746 14:102058023-102058045 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1125574483 15:40745986-40746008 CTTTGCAGCCAGAAGCAAGAAGG + Intronic
1125600642 15:40913781-40913803 CTGTGTAGATAGAGGAAGGCAGG + Intergenic
1125883607 15:43212788-43212810 CTGGGAAGCTAGAAGCAGGAGGG + Intronic
1126460807 15:48913314-48913336 CTGTGTACCTAGAAGGATTATGG + Intronic
1126552320 15:49946637-49946659 CTGGGTTGCAAGAAACAGGAAGG - Intronic
1127042071 15:54988075-54988097 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1127233316 15:57020023-57020045 CTGTGAGGCTAGAAGCAAGGTGG + Intronic
1127642286 15:60927447-60927469 CCCTGTAGTTAGAAGTAGGAAGG - Intronic
1127812858 15:62579667-62579689 GTCTGTAGCTAGGAGAAGGAGGG - Intronic
1128479345 15:68023839-68023861 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1130289500 15:82584699-82584721 CTGTGTAGATAGATGCATTATGG - Intronic
1130771926 15:86933190-86933212 CTGTAAGGCTACAAGCAGGATGG - Intronic
1131661814 15:94525260-94525282 TTGTGAGGCTAGAAGCAAGATGG + Intergenic
1132991339 16:2796696-2796718 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1133217853 16:4304307-4304329 CTGTGTAGCTAGAACCAACGGGG + Intergenic
1133312718 16:4860649-4860671 CTGTGAAGCTGCAAGCAAGAGGG - Exonic
1133439898 16:5812290-5812312 TTGAGTAGCTAGAAGTAGAAAGG + Intergenic
1133678629 16:8099453-8099475 GTGTGGAGCCAGAAGCAGAAAGG + Intergenic
1133920314 16:10146916-10146938 TTGTGTAGGTAGTAGCAAGAGGG - Intronic
1134005645 16:10817551-10817573 CTGTCTAGCTAGACTCAGCAGGG + Intronic
1135356429 16:21772881-21772903 CTGTGAGGCTAGAAACAAGATGG + Intergenic
1135454925 16:22589025-22589047 CTGTGAGGCTAGAAACAAGATGG + Intergenic
1135520451 16:23172838-23172860 CTGTGTGGCAAGGACCAGGAAGG + Intergenic
1135671229 16:24377238-24377260 CTGTGAAGCTAGTAGCAAGATGG - Intergenic
1136398005 16:30003509-30003531 CTGTGAAGACAGAAGCAGGTTGG + Intronic
1136934072 16:34442796-34442818 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1136970500 16:34969018-34969040 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1138299796 16:55916469-55916491 CTATGAGGCTAGAAGCAAGATGG + Intronic
1138731675 16:59201949-59201971 CTGTAAGGCTAGAAGCAAGATGG + Intergenic
1138860507 16:60750222-60750244 CTGCGAGGCTAGAAGCAAGATGG + Intergenic
1139143145 16:64292681-64292703 CTGTGAGGCTAAAAGCAAGATGG - Intergenic
1139487073 16:67263954-67263976 CTGTGTAGCTAGAAGGGGGCAGG + Intronic
1140866345 16:79065820-79065842 CCGTGGGGCTAGAAGCAAGATGG + Intronic
1141442315 16:84037322-84037344 CTGTGTGGCATGAAGCAGGATGG + Intronic
1143049202 17:4109411-4109433 CTGTGTGACGAGGAGCAGGAAGG + Intronic
1143419691 17:6779099-6779121 CAATGTAGCTAGATACAGGAAGG + Intronic
1143804638 17:9416281-9416303 CTGAGAGGCTAGAAGCAGGATGG - Intronic
1143861862 17:9897127-9897149 CTGTGGAGTTGGAAGTAGGAGGG - Exonic
1143985776 17:10912504-10912526 CTGTGAGGCTAGAAGCAAAATGG + Intergenic
1143994706 17:10996623-10996645 CTTTGGGGCAAGAAGCAGGAGGG - Intergenic
1144256723 17:13475740-13475762 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1146214267 17:30966249-30966271 CTGTGAGGCTAGCAGCAAGATGG + Intergenic
1146534481 17:33638379-33638401 CTGTGAGGATAGAAGCAAGATGG + Intronic
1146596416 17:34173000-34173022 CTGTGAGGCTAGAAGGAAGATGG + Intronic
1147725794 17:42565498-42565520 CTGTGTTGCTTGAAGCCGGCTGG + Exonic
1148642381 17:49197769-49197791 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1151000613 17:70370955-70370977 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1152702942 17:81828489-81828511 GTGTGTACCTAGGAGCAGAATGG - Intronic
1153282207 18:3425229-3425251 CTGTGAGGATAGAAGCAAGATGG - Intronic
1154205841 18:12336016-12336038 GTGTGAGGCTAGAAGCAAGATGG - Intronic
1155357208 18:24964750-24964772 CTGGGAGGCTAGAAGCAAGATGG + Intergenic
1155938380 18:31777885-31777907 CTATGAGGCTAGAAGCAAGATGG - Intergenic
1156795875 18:41045582-41045604 CTGTGTGTCTGGAAGCAGAATGG - Intergenic
1157959310 18:52134541-52134563 CTGTGAGGCTAGAAGCAGGATGG + Intergenic
1158462886 18:57662139-57662161 CTCTGGAGGTTGAAGCAGGAGGG - Intronic
1161680236 19:5676492-5676514 CTCGATAGCTGGAAGCAGGACGG - Intronic
1164308871 19:24029365-24029387 CTGTGTGGCAAGAATCAGGTAGG + Intergenic
1164518777 19:28960752-28960774 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1164531069 19:29048624-29048646 TTCTGTATCTACAAGCAGGAAGG - Intergenic
1165368729 19:35388481-35388503 CTGTAAGGCTAGAAGCAAGACGG - Intergenic
1166262473 19:41650456-41650478 TTGTGAAGTTAGAAGCAAGATGG + Intronic
1167810680 19:51827277-51827299 CTTTGAGGCTAGAGGCAGGAAGG + Intergenic
925170393 2:1746623-1746645 GTGTGTAGCTAGAATCATGCTGG - Intergenic
925852028 2:8091137-8091159 CTGTGTAGCCAGAATGAGGGAGG - Intergenic
926007532 2:9384308-9384330 CTGTGAGGCCAGAAGCAAGATGG + Intronic
927459824 2:23288709-23288731 CTGTGGAGCTACAAGGAGGGAGG - Intergenic
927501410 2:23585724-23585746 ATATGTAACTAGAAGCAGGAGGG + Intronic
928671314 2:33606359-33606381 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
928931194 2:36626103-36626125 CTGTGAGACTAGAAGCAAGATGG + Intronic
929271420 2:39976615-39976637 CTGTGTAGCTATAGGCTGGGCGG - Intergenic
930164442 2:48190368-48190390 CTGAGAGGCTAGAAGCAGGATGG + Intergenic
930506938 2:52294307-52294329 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
930571485 2:53091833-53091855 CTGTGAGGCTAGAAACAAGATGG + Intergenic
930711239 2:54552907-54552929 CTGGGCAGCTAGAAGCAGTCAGG - Intronic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931441111 2:62291259-62291281 CTGTGAGGCCAGAAGCAAGATGG - Intergenic
931453027 2:62384478-62384500 TTGTGAGGCTAGAAGCAAGATGG + Intergenic
931874213 2:66494782-66494804 CTTTGTGGGTAGAAGAAGGAAGG + Intronic
933138936 2:78769669-78769691 CTTTGAGGCTAGAAGCAAGATGG - Intergenic
933311341 2:80665407-80665429 CTGTGTATTAAGAAGCTGGAGGG + Intergenic
934181497 2:89626407-89626429 TTATGTACCTAGAAGCAGAAAGG + Intergenic
934291800 2:91700626-91700648 TTATGTACCTAGAAGCAGAAAGG + Intergenic
935009362 2:99117821-99117843 CTGTGTGACTGGAATCAGGAAGG + Intronic
935156266 2:100486214-100486236 CTGTGGGGTTAGAAGCAAGATGG + Intergenic
936684084 2:114807189-114807211 ATCTTTACCTAGAAGCAGGAGGG + Intronic
937010578 2:118559383-118559405 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
937469726 2:122164836-122164858 CTCTGGAGCAGGAAGCAGGAAGG + Intergenic
937712875 2:124997807-124997829 CTGTGAGGGTGGAAGCAGGATGG + Intergenic
938242938 2:129757166-129757188 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
938372476 2:130780484-130780506 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
939870889 2:147524620-147524642 AAGGGTAGCTAGAAGGAGGAAGG + Intergenic
939973847 2:148693699-148693721 TAGTGTAGCTTGAAGCATGATGG - Intronic
941960116 2:171245222-171245244 CTGTGAGACTAGAAGCAAGATGG - Intergenic
943569784 2:189559737-189559759 CTGTGTAGGAAGAAGAAGCATGG - Intergenic
944083065 2:195811855-195811877 CTGTGAGGCCAGAAGCAAGATGG - Intronic
944880196 2:204005309-204005331 CTCTTTAGAAAGAAGCAGGATGG - Intergenic
945260271 2:207836669-207836691 GTGTGCAGCTAGAATCTGGAAGG - Intronic
946663810 2:222028804-222028826 CTGTGAGGCTAGAAGCGAGATGG - Intergenic
946760226 2:222986037-222986059 CTGTGAGGCTAGAAGCAAAATGG + Intergenic
947876640 2:233471881-233471903 CTGTGCAGAGAGAGGCAGGAAGG + Exonic
1168901880 20:1371681-1371703 CTGTGTTTCTAGAAGCTAGAGGG - Intronic
1171398216 20:24854056-24854078 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1172082552 20:32353741-32353763 CTGAGTAGCTAGGAGTAGGTAGG - Intergenic
1173849189 20:46207244-46207266 CAGTGCAGATAAAAGCAGGAGGG + Intronic
1174913988 20:54636158-54636180 CTGTGAGGCTAGAATCAAGATGG - Intronic
1176273745 20:64251417-64251439 CTGGGTAGCATGGAGCAGGACGG - Intergenic
1176730983 21:10496810-10496832 TTATGTACCTAGAAGCAGAAAGG - Intergenic
1177374193 21:20247937-20247959 ATTTTTAGCAAGAAGCAGGAAGG - Intergenic
1181265194 22:21627010-21627032 ATGAGTGGGTAGAAGCAGGAAGG + Intergenic
1182560307 22:31154221-31154243 CCGAGTAGCTGGAAGCAGGCAGG - Intergenic
1183287350 22:36975667-36975689 CTGTGAGGTTAGAAGCAAGACGG - Intergenic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1184156580 22:42671464-42671486 CCGTGAGGCTGGAAGCAGGATGG + Intergenic
1184847435 22:47097916-47097938 CTGTTTACCTGGAAGTAGGAGGG + Intronic
1184952559 22:47854645-47854667 GTGTGAGGGTAGAAGCAGGAAGG - Intergenic
1185318769 22:50190707-50190729 GTGTGTAGCTAGACCCAGGGAGG + Intronic
951219640 3:20055610-20055632 CTGTGTGGCTAGATGGAGGTGGG + Intronic
951281278 3:20752912-20752934 CTGAGTACCTAGAAACAGGATGG - Intergenic
952266656 3:31793504-31793526 CTGTGTAGGTTTAAGGAGGATGG + Intronic
953232714 3:41078781-41078803 CTCTGGAGCTAGACACAGGAAGG + Intergenic
954060659 3:48063986-48064008 CTGGGAGGTTAGAAGCAGGATGG - Intronic
954894884 3:53966703-53966725 CTGTGAAGCTAGAAGCAGGATGG - Intergenic
956135739 3:66096760-66096782 CTGTGAGGCTAGAAGCAAGAAGG + Intergenic
956458116 3:69443661-69443683 GTGTGTTGCTGGAAGCAAGATGG - Intronic
959152907 3:102629116-102629138 CTGTGAGGCTAGAAGCAAAATGG - Intergenic
959350753 3:105260130-105260152 CTGTGAGGCTAGAAACAAGATGG - Intergenic
960147018 3:114214366-114214388 CTGTGAGGTTCGAAGCAGGAAGG + Intergenic
960557341 3:119043782-119043804 CTGGGTGGCTAGATGCAGAAGGG + Intronic
961264742 3:125632798-125632820 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
962610727 3:137073905-137073927 CTTTGTAGTTTGAAGCAAGAAGG + Intergenic
963016235 3:140826762-140826784 CTGTGTAGGCAAAGGCAGGATGG - Intergenic
963328815 3:143891866-143891888 CTGTGTATCTATAAACAGGTTGG - Intergenic
963623054 3:147635744-147635766 CTGGGTGGCTAGATGCAGAAGGG + Intergenic
963693714 3:148537374-148537396 GTGTGAGGCTAGAAGCAAGATGG + Intergenic
964498063 3:157316308-157316330 TTATGCAGCTAGAAGCAGGGAGG - Intronic
965635905 3:170780242-170780264 CTGTGTTTCTGGATGCAGGAGGG - Intronic
965777811 3:172251375-172251397 TTTTGTAGATAGAAGAAGGAGGG - Exonic
965870723 3:173261238-173261260 CTGTGAGGCTAGAAGTAAGATGG + Intergenic
966756480 3:183376219-183376241 CTGTGTGGCAAGAAGCAGGCAGG - Intronic
967465943 3:189806251-189806273 CTGTGTAGCTAGAAGCAGGAGGG + Intronic
968509803 4:990679-990701 ATGTGTAGGAAGCAGCAGGAAGG - Intronic
969173800 4:5384315-5384337 CTCTGCAGGTAGAAGCAGCAGGG + Intronic
969500414 4:7549266-7549288 CTGAGTTGAAAGAAGCAGGAAGG - Intronic
970196838 4:13559561-13559583 AAGTGTGGCTAGAAACAGGAAGG + Intergenic
971642913 4:29158377-29158399 CTGTGAAGCTAGAAGCAAGATGG + Intergenic
971659161 4:29389810-29389832 CTGTGTAGCTAGAAGCAAGATGG - Intergenic
971975565 4:33681662-33681684 CTGTGAGGCTAGAAGAAAGATGG + Intergenic
973074039 4:45900587-45900609 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
974416078 4:61607940-61607962 CTGTGAGGCTAGAAGCAAGATGG + Intronic
975387960 4:73780746-73780768 CTGTGTTGATAGAGGTAGGAAGG + Intergenic
975581630 4:75912004-75912026 CTGTGAGGCTAGAAGGAAGATGG + Intergenic
975715655 4:77203402-77203424 CTGTGTCCCTAGCAGCAGCAGGG + Intronic
975796644 4:78012922-78012944 CTGTGTACCAAGAAGAATGATGG - Intergenic
975851054 4:78572965-78572987 CTGTGAGGCTAGAAGCAAGATGG + Intronic
976322192 4:83728376-83728398 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
976895160 4:90100398-90100420 CTGTGAAATTAGAAGCAAGATGG + Intergenic
977672671 4:99714429-99714451 CTGTGAGGCTAGAAGCAAAATGG - Intergenic
978445696 4:108777960-108777982 TTGTGGGGCTAGAAGCAAGATGG + Intergenic
978829023 4:113060461-113060483 CTATGTAGATTCAAGCAGGAAGG - Intronic
979132727 4:117068782-117068804 GTGTGTAGCTAGACACAGAAAGG + Intergenic
979350902 4:119643452-119643474 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
979458525 4:120953322-120953344 CTGTGAGGCTAGAGGCAAGATGG - Intergenic
979746567 4:124221636-124221658 ATGTGAAGATAGAAGCAGAATGG + Intergenic
980087195 4:128403623-128403645 CTGTGTACCTAGAAGGATTATGG + Intergenic
980564277 4:134518336-134518358 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
981347655 4:143695841-143695863 CTGATTAGCTACAAGCATGACGG - Exonic
982106067 4:152013123-152013145 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
982846729 4:160262467-160262489 CTGAGTAGCTAAAAGCAGTGTGG - Intergenic
983626328 4:169805291-169805313 CTGTGAGGCTAGAAGCAAGAAGG - Intergenic
983759883 4:171393175-171393197 ATGTGAAGTTAGAAGCAAGATGG - Intergenic
984191356 4:176609733-176609755 GTTTGGAGCTAGAAGTAGGAGGG - Intergenic
984884801 4:184440697-184440719 CTGTGAAGCTGGAGGCAGGGAGG - Intronic
985100482 4:186453257-186453279 CTGTGGGGCTAGAAGCAAGATGG + Intronic
985339486 4:188934104-188934126 CTTGGAGGCTAGAAGCAGGATGG - Intergenic
985714528 5:1447933-1447955 CTGTGCAGGTAGAAGCAGTGTGG + Intergenic
985925439 5:3012542-3012564 CTGTGTCTGTAGAATCAGGATGG - Intergenic
986013666 5:3739335-3739357 CTGTGCAGCCTGAAGCTGGAGGG - Intergenic
986241487 5:5964149-5964171 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
986544881 5:8884899-8884921 CTCTGTAGCTAGAAGAGGGCAGG + Intergenic
987156031 5:15090389-15090411 GAGTCTAGCTAGAAACAGGAGGG + Intergenic
987733411 5:21806776-21806798 CTGTGAGGCTAGAAGCAAGATGG - Intronic
988217954 5:28301390-28301412 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
988263834 5:28926599-28926621 CTGCGTAGCGAGAACCGGGAGGG + Intergenic
988473533 5:31563355-31563377 CTGTGAGGCTAGAAGCAAGACGG - Intergenic
988558576 5:32260104-32260126 TTGTGCAGCTAGAAGCAAAAAGG + Intronic
988681964 5:33492247-33492269 ATGTGAAGCTGGAAGCAAGATGG + Intergenic
988854492 5:35214712-35214734 CTGTGAGGTTAGAAGCAAGATGG - Intronic
988866998 5:35346096-35346118 CTGTGAGGCTAGAAGCAATATGG + Intergenic
990260130 5:54013332-54013354 CTGTGAGGTTAGAAGCAAGATGG - Intronic
990325545 5:54671880-54671902 CTGTGAGACTAGAAGCAAGATGG - Intergenic
990672721 5:58150668-58150690 GTGTGTGGCTAGAAGCTGAATGG - Intergenic
990703629 5:58502306-58502328 CTGTGTATGTAGCAGCAAGAAGG + Intergenic
990839710 5:60063474-60063496 CTCTGAGGCTAGAAGCAAGATGG - Intronic
991679836 5:69127822-69127844 ATGAGAAGCCAGAAGCAGGAAGG - Intronic
992959025 5:81940269-81940291 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
993352657 5:86868911-86868933 CTATGAAGCTAGAAGCAAAATGG + Intergenic
993416538 5:87639895-87639917 CTGTAAAGCTAGAAGCAAGATGG + Intergenic
993425569 5:87760242-87760264 CCTTGTAGCTATAAGGAGGAAGG - Intergenic
994840869 5:104923586-104923608 CTGTGATGCTAGAAGCAATATGG + Intergenic
994926250 5:106120721-106120743 CTGTGAACCTGGAGGCAGGAGGG - Intergenic
995075451 5:107978196-107978218 GTGTGTGGCTAGAAGCAAGATGG - Intronic
995675033 5:114653889-114653911 GTGTGCACCTAGAGGCAGGAGGG + Intergenic
996413454 5:123183802-123183824 CTGTTTAGTAAGAAGGAGGAAGG - Intronic
996787444 5:127255540-127255562 CTATGAAGCTAGAAGCAAGATGG + Intergenic
997212458 5:132085493-132085515 CTGTGGGGAGAGAAGCAGGAAGG - Intergenic
997828650 5:137130082-137130104 CTGTGAAGCTAGAGGCAAGATGG + Intronic
998142211 5:139706349-139706371 CTGTGTACCTAGAACCCGGCTGG + Intergenic
999869352 5:155732860-155732882 CTATTTGGCTGGAAGCAGGAGGG - Intergenic
1000720925 5:164705601-164705623 CTGTGTTGGTAGAGGTAGGATGG + Intergenic
1001192606 5:169644502-169644524 CTGAATAGCTAGAAGAATGAGGG + Intronic
1001207693 5:169779621-169779643 CTGCATAGCTAGAAGCTGGTGGG - Intronic
1002677998 5:180935049-180935071 CTATGAAGTGAGAAGCAGGAAGG - Intronic
1003199849 6:3949370-3949392 CTGTGAAGTTAGAAGCAAGATGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003819387 6:9878800-9878822 CTGTGGTGCTAGAAGCAATATGG - Intronic
1004279922 6:14271929-14271951 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1004604414 6:17180314-17180336 CTGTGAGGCTAGATGCAAGATGG + Intergenic
1005103546 6:22199320-22199342 CTGTGATGTTAGAAGCAAGATGG + Intergenic
1005391121 6:25334233-25334255 CTGTGTGTCCAGAATCAGGAAGG - Intronic
1007054130 6:38864720-38864742 TCGTGTAACTAGAAACAGGAAGG + Intronic
1008103412 6:47416897-47416919 CTGTGAAGCCAAAAGCAAGATGG + Intergenic
1008104387 6:47426754-47426776 TTGTGAAGCTAGAAGCAAGATGG - Intergenic
1008675016 6:53810042-53810064 CTCTGTAGCGGGAAGCAGGTAGG + Intronic
1009033589 6:58090146-58090168 CTCTGTAGCTAGAGGCAGTTTGG - Intergenic
1009209202 6:60841855-60841877 CTCTGTAGCTAGAGGCAGTTTGG - Intergenic
1012248336 6:96952452-96952474 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1013067505 6:106698092-106698114 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
1013680709 6:112522411-112522433 CTGTGAGGCTAGAAGGAAGATGG - Intergenic
1013769705 6:113614012-113614034 CTGCGAGGCTAGAAGCAAGATGG + Intergenic
1014278515 6:119416028-119416050 CTGGGTGGCTAGACCCAGGAGGG - Intergenic
1015173175 6:130277374-130277396 CTGTAAGGCTAGAAGCAAGATGG + Intronic
1015195266 6:130518615-130518637 CAGTGTAGCCAGGAGCAGAAAGG - Intergenic
1015464106 6:133528702-133528724 CTGTGTGGTTAGGAGAAGGAGGG - Intronic
1016354559 6:143204049-143204071 ATTTGTAGATAGAAGAAGGAAGG + Intronic
1017039610 6:150297077-150297099 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1019465697 7:1187317-1187339 CTGTTTAGCAAGAAGGAGGAAGG + Intergenic
1019648796 7:2145107-2145129 CTGTGGAGCCAGGAGCAGGCAGG - Intronic
1020450980 7:8320154-8320176 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1021420963 7:20444251-20444273 CTGTGAGACTAGAAGCAAGAAGG - Intergenic
1021737428 7:23653572-23653594 CTGTGTGTCAAGAAACAGGATGG + Intergenic
1021822982 7:24516457-24516479 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1024002672 7:45201291-45201313 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1024248997 7:47492257-47492279 CTGTTTGGCCAGCAGCAGGAAGG + Intronic
1024305401 7:47924748-47924770 CTGTGAAGTTAGAAGCAAGATGG + Intronic
1024378598 7:48667880-48667902 CTGTGAGGCTAGAAGCAAGGGGG + Intergenic
1024407168 7:48995102-48995124 CTTTGAAGCCAGAAGCAAGAGGG + Intergenic
1025998347 7:66542732-66542754 GGGTGAAGCTAGAAGCAGGCAGG - Intergenic
1026158166 7:67845837-67845859 CTTTGCAGCAAGAAGAAGGAAGG - Intergenic
1026519392 7:71103248-71103270 CTGTGAAGTTAGAAGCAAGATGG + Intergenic
1027161360 7:75804843-75804865 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1027871247 7:83710869-83710891 CTATGAAGTTAGAAGCAAGACGG + Intergenic
1027971050 7:85082471-85082493 CTGTTAAGCTATAAGCAAGAAGG + Intronic
1028193696 7:87880206-87880228 CTGTGGAGATAGAAGAAAGAAGG - Intronic
1028653126 7:93172428-93172450 CTGGGAGGCTAGAAGCAAGAAGG + Intergenic
1030365108 7:108637121-108637143 CTTAGTAGCTTGAAACAGGATGG + Intergenic
1030909818 7:115233322-115233344 CTGTCCAGGTAGAAACAGGATGG + Intergenic
1030939760 7:115631438-115631460 CTAGGTAGCTAGAATTAGGATGG + Intergenic
1031459677 7:122032433-122032455 CACTGTAGCTGTAAGCAGGAAGG + Intronic
1033077101 7:138259851-138259873 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1033668085 7:143462523-143462545 TTGTGAGGCTAGAAGCAAGATGG + Intergenic
1034067766 7:148153124-148153146 CTGTGAGGCTAGAAGCAGGACGG + Intronic
1034543984 7:151777665-151777687 CTGTGAGGCTGGATGCAGGATGG - Intronic
1034851234 7:154495840-154495862 GTGTGTACCCAGATGCAGGAAGG + Intronic
1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG + Intergenic
1035037653 7:155905869-155905891 CTGTGTACCTAGAACCAGGGTGG - Intergenic
1037585075 8:20270543-20270565 CAGAGTAGAAAGAAGCAGGAAGG + Intronic
1038280180 8:26156905-26156927 CTGTGCAGCCAGAAGCAAGATGG + Intergenic
1038403433 8:27304198-27304220 TGGTATAGCTGGAAGCAGGAAGG + Intronic
1038699461 8:29836334-29836356 CTGTGAGGCTAGAGGCAGGATGG - Intergenic
1039113616 8:34067676-34067698 TTATGAAGCTAGAAGCAAGATGG - Intergenic
1039300713 8:36205736-36205758 CTGTGAAGGTAGAGGCAAGATGG + Intergenic
1039303153 8:36231879-36231901 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1039727306 8:40232736-40232758 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1039959904 8:42238298-42238320 CTGTAAGGCTAGAAGCAAGATGG - Intergenic
1040028564 8:42803748-42803770 CTGTGCAGCTTGCGGCAGGACGG + Intergenic
1040040686 8:42914128-42914150 AGGTGTGGCTAGAAGCAGTATGG - Intronic
1041055277 8:53979465-53979487 CTGTGACACTAGAAGCAAGATGG - Intronic
1042207232 8:66341775-66341797 TTGTGAGGCTAGAAGCAGGACGG - Intergenic
1042466646 8:69135934-69135956 CTGGGTAGCTAGACCCAGAAAGG - Intergenic
1042824429 8:72965716-72965738 CTGCGAGGCCAGAAGCAGGATGG + Intergenic
1042948095 8:74174875-74174897 CTGTGAGGCTAGAAGCAGGATGG + Intergenic
1043379969 8:79691997-79692019 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1043947049 8:86265083-86265105 CTGTGAAGCTAGAAGCAAGATGG + Intronic
1044233103 8:89801464-89801486 CTGTGAGACTAGAAGCAAGAGGG - Intergenic
1044243462 8:89913331-89913353 CTTTGAAGCTAGAAGCAAGATGG + Intronic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044573812 8:93747482-93747504 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1044908419 8:97030016-97030038 GTGTGAAGCTTGAAGCAGGAAGG + Intronic
1045646781 8:104307180-104307202 CTGTAAGGCTAGAAGCAAGATGG - Intergenic
1045648008 8:104317985-104318007 CTGAGAGGCTAGAAGCAAGATGG + Intergenic
1045649353 8:104327969-104327991 CTGTGAAGCTAGAAGCAAGATGG + Intergenic
1045734196 8:105276142-105276164 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1047458200 8:125036184-125036206 CTGTGTATCTGGAACCATGATGG - Intronic
1047734760 8:127755454-127755476 CTCTGTGGCTAGAAGAGGGAAGG - Intergenic
1049204117 8:141355447-141355469 CTGTGTGGCTGGGAGCAGGAGGG - Intergenic
1049422704 8:142523977-142523999 CTGTGTGGCTCTAAGCAGGTGGG + Intronic
1049505185 8:142992371-142992393 CTGTGTCCCTGCAAGCAGGAAGG + Intergenic
1049513237 8:143040126-143040148 CTGTGGTGCTAGAGGCAGGGGGG + Intronic
1049950013 9:634741-634763 CTGTGAGGCCAGAAGCAAGATGG + Intronic
1050168665 9:2792933-2792955 CTGTGAGGCTATAAGCAAGATGG + Intronic
1050348185 9:4714489-4714511 CAGTGAATTTAGAAGCAGGAGGG - Intronic
1050983078 9:12045873-12045895 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1051269756 9:15344033-15344055 TTGTGAAGTTAGAAGCAAGATGG - Intergenic
1052729170 9:32265119-32265141 CTGTGAAGCTAGAAGCAAGATGG + Intergenic
1053178713 9:35949234-35949256 CTGGGAAGCTAGAGACAGGAAGG - Intergenic
1054728834 9:68679774-68679796 CTGTGTATCTAGGAGCATTATGG + Intergenic
1055022044 9:71680437-71680459 CTGTGTAGATAGAATCATTAAGG + Intergenic
1055191194 9:73527028-73527050 CTGTAAGGCTAGAAGCAAGATGG - Intergenic
1055468146 9:76585620-76585642 CTGTGAGGCTTGAAGCAAGATGG + Intergenic
1055520899 9:77080161-77080183 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1055576586 9:77666031-77666053 CTATGTACCAAGAAGAAGGAAGG - Intergenic
1056897495 9:90564500-90564522 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1056956510 9:91086008-91086030 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1057400823 9:94721458-94721480 CTGTGAGGCTGGAAGCAAGATGG + Intergenic
1057920087 9:99090155-99090177 TTGTGAGGCTAGAAGCAAGATGG + Intergenic
1058438372 9:104985247-104985269 CTTTGTAGCTAGCAGCAGAGGGG + Intergenic
1058603827 9:106699572-106699594 CTGTGAATCACGAAGCAGGAGGG - Intergenic
1060473972 9:123971333-123971355 CTGTGCAGCTGGCAGCAAGAGGG - Intergenic
1060597464 9:124856897-124856919 ATGGGTAGGTAGGAGCAGGATGG - Intronic
1186027441 X:5328220-5328242 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1186047900 X:5556227-5556249 CTGTGTGGCTAGAAGCAAGCTGG - Intergenic
1186450126 X:9665407-9665429 CTGTGAAGCTAGAGACAAGATGG - Intronic
1186610559 X:11134549-11134571 CTGTATATCTGGGAGCAGGAGGG + Intergenic
1186807336 X:13153382-13153404 TTGTGAGGCTAGAAGCAAGATGG - Intergenic
1187112715 X:16318061-16318083 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1187136339 X:16551157-16551179 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1189363908 X:40373633-40373655 CTGTGTATCTAGGAGCTAGAGGG + Intergenic
1189962842 X:46340812-46340834 TTGTGAGGCTAGAAGCAAGATGG + Intergenic
1193277338 X:79604730-79604752 CTGCCTAGCTACAAGCAGCAGGG - Intergenic
1193910541 X:87300935-87300957 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1195491619 X:105477106-105477128 TTGTGTGCCTAAAAGCAGGATGG + Intronic
1197347750 X:125345272-125345294 CTGTGAGGCTAGAAGCAAGAAGG + Intergenic
1197652627 X:129082368-129082390 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1199555941 X:149108845-149108867 CTGTGAAGCTAGAACCAAGAAGG - Intergenic
1201642031 Y:16190397-16190419 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1201660784 Y:16394924-16394946 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1201771410 Y:17620412-17620434 CTGTGTGGCAAGGATCAGGAAGG + Intergenic
1201830145 Y:18285574-18285596 CTGTGTGGCAAGGATCAGGAAGG - Intergenic