ID: 967467962

View in Genome Browser
Species Human (GRCh38)
Location 3:189829233-189829255
Sequence GAATCCTCTTTTAAGATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967467962 Original CRISPR GAATCCTCTTTTAAGATGGT TGG (reversed) Intronic
901748922 1:11393956-11393978 GCACCCTCTTTAGAGATGGTGGG - Intergenic
909724609 1:78819382-78819404 GAAATCACATTTAAGATGGTAGG - Intergenic
910850801 1:91648338-91648360 GAATTCTCTTTTAAGAATGTTGG + Intergenic
912317867 1:108682445-108682467 GGCTCCTTTTTTTAGATGGTAGG + Intergenic
913148169 1:116012865-116012887 GGATCCTCTTTCATGATGCTGGG + Intronic
913266770 1:117052812-117052834 CAATGCTTATTTAAGATGGTAGG - Intergenic
916870074 1:168904094-168904116 TAATCCTCTTTTAAGAAGAAGGG - Intergenic
918872343 1:189991756-189991778 CCATCCTCTGTTAAGATTGTAGG + Intergenic
920010453 1:202863409-202863431 TAATCCTCTTATAAGCTGTTTGG + Intergenic
920945768 1:210527104-210527126 CAATCCTCTTATCAAATGGTTGG - Intronic
922634672 1:227155894-227155916 GAATCCTCATCTACCATGGTAGG + Intronic
923742072 1:236664156-236664178 GAAGCCTCTTTCCAGATGGTAGG - Intergenic
924454672 1:244209715-244209737 ATTTCCTCTTTTAAGAAGGTTGG + Intergenic
1069611326 10:69774560-69774582 GAGCTCTCTTTTAAGATGGTGGG - Intergenic
1070054950 10:72925510-72925532 AATTCCTCTTTTAAGAAGTTTGG + Intronic
1071035604 10:81240425-81240447 GAATTTTATTTTAACATGGTTGG + Intergenic
1071743243 10:88386257-88386279 GAATCCTTTTTTTGGATGGGTGG + Intronic
1073284515 10:102379634-102379656 GAGTCCTGTTTTAACAAGGTGGG + Exonic
1075279943 10:121130546-121130568 GCATCCTCTTTTAGGGTGGCTGG - Intergenic
1080802458 11:35620176-35620198 GAATCCTTTTATAAGCTGGGTGG - Exonic
1083079883 11:60080282-60080304 AATGCCTCTTTTAAAATGGTTGG - Intergenic
1086344154 11:85878786-85878808 GATCCCTCTTATATGATGGTGGG - Intronic
1086889969 11:92246167-92246189 GAATACTCTTTTAAGAAGTTTGG + Intergenic
1088990997 11:114953468-114953490 GAATCCTCTTTTAAAAAACTTGG + Intergenic
1089293085 11:117450170-117450192 GAACCATCTTTCAACATGGTTGG - Intronic
1092915746 12:13187539-13187561 GTATCCTCTTTTAAGATACTTGG + Intergenic
1093621393 12:21294132-21294154 GAATCCTCTTTTAATATCTATGG - Intronic
1095494836 12:42773375-42773397 GAATCGTTTTGTGAGATGGTGGG + Intergenic
1095513444 12:42979130-42979152 AAATCCCCTTTTAAAAGGGTAGG - Intergenic
1098429889 12:70407785-70407807 TAATCCTCTATTCACATGGTTGG + Intronic
1099127704 12:78785888-78785910 TAGTCCTCTTTTAAAATGTTGGG - Intergenic
1100908414 12:99329922-99329944 GAATGCACTTTAAAGAGGGTGGG - Intronic
1102764035 12:115415459-115415481 GAATATTCTTTTAAGAGGGTGGG - Intergenic
1105749392 13:23408174-23408196 GAATCCTCTCTTATGTTGGGGGG - Intronic
1106184324 13:27395513-27395535 GAATCAACTTTTATGGTGGTGGG - Intergenic
1107185917 13:37519906-37519928 GAATAAACATTTAAGATGGTAGG - Intergenic
1109010212 13:56931054-56931076 GTACCCTCTTTTATGATGTTTGG - Intergenic
1110604327 13:77414092-77414114 GAATCCTTTTTTAAGCTTATTGG - Intergenic
1111315945 13:86559884-86559906 GAATGCTCTTTTAAAAAGGGAGG - Intergenic
1117791263 14:59344354-59344376 GAATACTGTTTTAAGATGGCTGG + Intronic
1119133984 14:72200195-72200217 GCATCCTATTTTAAGAAAGTAGG - Intronic
1120449190 14:84644265-84644287 AAATCCTCTTTTAATAAGGATGG - Intergenic
1120820588 14:88908365-88908387 GAATCCAGTTTTCAGATGGCAGG + Intergenic
1127124145 15:55795872-55795894 GAATCCTCTTTTGAGAGGATTGG + Intergenic
1127182258 15:56433742-56433764 GCATGCTATTTTAAGAAGGTGGG - Intronic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1131619847 15:94056359-94056381 GATTCCCCTTTTCTGATGGTGGG - Intergenic
1134390332 16:13814080-13814102 GAATCCATTTTCAAGATGGCTGG + Intergenic
1141145962 16:81530231-81530253 GAATCCTCTAGTAAGAAGGCTGG - Intronic
1141308545 16:82890416-82890438 GAATCGTTTTTAAAGAGGGTTGG - Intronic
1146153902 17:30503125-30503147 TCTTCCTCTTTTAAAATGGTAGG - Intronic
1147868956 17:43573875-43573897 GCAACCCCTTTTAAGTTGGTTGG + Intronic
1148780726 17:50119957-50119979 GAATCCGTTTGTAGGATGGTAGG - Intronic
1150520656 17:65864265-65864287 GAGTCATATTTTAAGATGCTGGG + Intronic
1152102777 17:78312607-78312629 TAATCTTTTTTTTAGATGGTTGG - Intergenic
1152883442 17:82833707-82833729 GTATCCGCTTTAGAGATGGTTGG + Intronic
1156655619 18:39282551-39282573 GCATCCTCTTTTAATATTGCAGG - Intergenic
1158313171 18:56181152-56181174 GGATCCTGGTTTAAAATGGTAGG + Intergenic
1164424025 19:28124270-28124292 GAACCCTCTTATAAGATTGCTGG - Intergenic
1168521052 19:57050748-57050770 CAATCCTCTAATCAGATGGTTGG + Intergenic
1168590329 19:57628861-57628883 GCATCCTCTTGAAAGATAGTTGG - Intergenic
925396883 2:3540339-3540361 GATTCCTCTTTAAAAGTGGTTGG + Intronic
931716896 2:65036336-65036358 GAATAATCTTTTAAGATAGAGGG + Intergenic
937948578 2:127365445-127365467 GAATCCTCTTTCCATAGGGTAGG + Intronic
938398283 2:130966397-130966419 TAATCCTGTTTGAATATGGTTGG + Intronic
938682874 2:133710138-133710160 GAATTCACTTTTAAGCTTGTTGG + Intergenic
941145862 2:161844478-161844500 ACATCCTCTTTTAGGATAGTTGG - Intronic
941885885 2:170526944-170526966 GAGGCCTCTTTTAAAATAGTTGG + Intronic
944073944 2:195705321-195705343 GAATTCTCTTTTAAGATACAGGG + Intronic
944989174 2:205215331-205215353 TAATCCTATTTTAAGAATGTTGG - Intronic
1169528793 20:6461029-6461051 GAGTCCTCATTTAACATTGTTGG + Intergenic
1182748500 22:32623868-32623890 GAACCCTCTTTTATGGTGGGAGG - Intronic
1183762677 22:39837840-39837862 GAATCCTTTCCTAAGATGGATGG - Intronic
950813235 3:15670885-15670907 GAATATTCTTTCAGGATGGTAGG + Intronic
953683887 3:45061047-45061069 GACTCCTCTTTCCAGATGGAGGG + Intergenic
956538634 3:70308390-70308412 AAACCCTCTTTTAAGATAATCGG - Intergenic
958141928 3:89572087-89572109 GAACCCTCTTCCAAGTTGGTGGG - Intergenic
962006362 3:131353858-131353880 CATTCCTCTTTCAAGATGATGGG + Intergenic
962058079 3:131895143-131895165 GAATCTTTTTTTAAGAAAGTTGG + Intronic
962144318 3:132824080-132824102 GAATCCTGTGGTATGATGGTGGG + Intergenic
964671003 3:159226244-159226266 TAATCCTCTATTCACATGGTTGG + Intronic
967467962 3:189829233-189829255 GAATCCTCTTTTAAGATGGTTGG - Intronic
972830503 4:42809441-42809463 GAATCCTATTTTTGGTTGGTAGG + Intergenic
973075748 4:45923695-45923717 GAATGCACTTTCAAGTTGGTAGG + Intergenic
976268632 4:83208312-83208334 GAATCCTATTTTAGGATTGTAGG + Intergenic
977017800 4:91715336-91715358 GGATCCTCTTTCAAGATCATTGG - Intergenic
977328475 4:95606665-95606687 AAATGCTCTTTTAAAATGGGAGG + Intergenic
978439952 4:108722995-108723017 GAAAGCTCTTTTAATATGTTTGG + Intergenic
980259484 4:130429474-130429496 GAATCCACTTATAATATGATAGG - Intergenic
980385041 4:132078050-132078072 GAACCCTCTTTTAAGTTTCTAGG - Intergenic
981474808 4:145178193-145178215 GAAGCCTCTTTTATTATAGTGGG - Intronic
981591572 4:146369546-146369568 GAATCATCATTTATGATAGTAGG - Intronic
987136134 5:14901246-14901268 GAATGCTCTTTCAAAATAGTTGG - Intergenic
987821193 5:22968976-22968998 GAAACATCTTTTAAGCTGATGGG + Intergenic
987912583 5:24168085-24168107 GAATCATCTTATAACATGTTTGG + Intronic
988104966 5:26733033-26733055 GAATTTTTTTTTAAGTTGGTAGG - Intergenic
988278294 5:29112196-29112218 AAATCTGCTTTTAATATGGTAGG + Intergenic
993295857 5:86138818-86138840 GAATCTTCTTATAATATGATGGG + Intergenic
994237203 5:97376546-97376568 CAGTACTCTTTTAGGATGGTTGG - Intergenic
1003008873 6:2407974-2407996 TGATCCTCTTTTGAGATGCTAGG + Intergenic
1004145874 6:13065569-13065591 TCATCTTCTTTTAAGATGTTTGG + Intronic
1007759463 6:44125050-44125072 GAGTCCACTTTTCAGGTGGTTGG - Intronic
1010950832 6:82035132-82035154 GAATTCTCTGTTAGGATTGTGGG - Intergenic
1013018764 6:106188592-106188614 CAATCCTTTTGTAACATGGTTGG - Intronic
1014425454 6:121299959-121299981 GAATCATTTTTAAATATGGTTGG - Intronic
1014972416 6:127834069-127834091 GACTCTTCTTTGAAGATTGTTGG - Intronic
1017340467 6:153315664-153315686 GAATCATTTTTTGAGATGATCGG - Intergenic
1018551147 6:165000250-165000272 AAATCCTGTTTTATGATGTTTGG + Intergenic
1021237794 7:18164417-18164439 TAATTCTCTTTTTAGATAGTGGG - Intronic
1023705549 7:42937972-42937994 GTATTGTTTTTTAAGATGGTAGG + Intronic
1029834946 7:103299218-103299240 GAATCCTCATTGAAGGTGGCAGG + Intronic
1036031817 8:4982058-4982080 GAATCCACTTCTAAGATAGTTGG - Intronic
1038940128 8:32295503-32295525 TAATCCTATTATAAGATGTTAGG - Intronic
1040912246 8:52530894-52530916 AAATCCACTTTTAATCTGGTGGG + Intergenic
1043129499 8:76443224-76443246 GAATGCTCATTTAACATGGGTGG + Intergenic
1049379891 8:142306803-142306825 GAATTTTCTTTTAAAAAGGTGGG - Intronic
1052904754 9:33823820-33823842 GAATCCTCTTGTAAGGTATTTGG + Intronic
1052933073 9:34071703-34071725 GACTCCACTTTTAGGAAGGTGGG + Intergenic
1053620404 9:39809122-39809144 GAATCCTTGTGTAAGATGCTGGG - Intergenic
1053626296 9:39874812-39874834 GAATCCTTGTGTAAGATGCTGGG + Intergenic
1053878573 9:42568421-42568443 GAATCCTTGTGTAAGATGCTGGG - Intergenic
1053894093 9:42725957-42725979 GAATCCTTGTGTAAGATGCTGGG + Intergenic
1054217592 9:62375889-62375911 GAATCCTTGTGTAAGATGCTGGG - Intergenic
1054233117 9:62533274-62533296 GAATCCTTGTGTAAGATGCTGGG + Intergenic
1054263752 9:62898321-62898343 GAATCCTTGTGTAAGATGCTGGG + Intergenic
1056437193 9:86586146-86586168 GAATCCTCTCTTAAAATGTTTGG + Intergenic
1058900443 9:109437993-109438015 GAATCCTCTTTCAAGATGTCGGG - Intronic
1060373495 9:123097649-123097671 TAATCCCATTTTAAGATGATGGG - Intronic
1186358215 X:8809718-8809740 GAAGCCTTTTTAAAGATGGCTGG + Intergenic
1186617247 X:11202285-11202307 GAAGCCTTTTTAAAGATGGCTGG - Intronic
1186819795 X:13275945-13275967 ATGTCCTTTTTTAAGATGGTGGG + Intergenic
1187541222 X:20197262-20197284 GAATCCACCTTTAAGGTGATAGG - Intronic
1190256072 X:48763243-48763265 GAATCAACTTTTAACATTGTTGG - Intronic
1191906595 X:66098935-66098957 TAATCCTCTTTTAAATTAGTAGG - Intergenic
1192986447 X:76404992-76405014 CAATACTCTTTTATGATGCTTGG - Intergenic
1194452038 X:94055776-94055798 GAAGGCTCGTTTAAGATGGGTGG - Intergenic
1196091457 X:111748100-111748122 GAAACATCTGTTAAGATGTTTGG + Intronic
1197577862 X:128242231-128242253 CAATGCTCTTATAAGATGGATGG + Intergenic
1198147357 X:133870719-133870741 GATTCCTCTTTTAATATATTTGG - Intronic
1198464687 X:136894290-136894312 GACGACTCTTTTAAGATGTTTGG - Intergenic
1202085298 Y:21130141-21130163 GAATTTTATTTTAAGATGGAGGG - Intergenic
1202330867 Y:23751216-23751238 TAATTCTCTTTGGAGATGGTGGG + Intergenic
1202539902 Y:25918845-25918867 TAATTCTCTTTGGAGATGGTGGG - Intergenic