ID: 967475712

View in Genome Browser
Species Human (GRCh38)
Location 3:189914989-189915011
Sequence CTTGCAAAACTGAATGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967475712_967475716 12 Left 967475712 3:189914989-189915011 CCACCCACATTCAGTTTTGCAAG No data
Right 967475716 3:189915024-189915046 CCTGAATCATCACCCTAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967475712 Original CRISPR CTTGCAAAACTGAATGTGGG TGG (reversed) Intergenic
No off target data available for this crispr