ID: 967475716

View in Genome Browser
Species Human (GRCh38)
Location 3:189915024-189915046
Sequence CCTGAATCATCACCCTAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967475712_967475716 12 Left 967475712 3:189914989-189915011 CCACCCACATTCAGTTTTGCAAG No data
Right 967475716 3:189915024-189915046 CCTGAATCATCACCCTAGAGCGG No data
967475713_967475716 9 Left 967475713 3:189914992-189915014 CCCACATTCAGTTTTGCAAGTCT No data
Right 967475716 3:189915024-189915046 CCTGAATCATCACCCTAGAGCGG No data
967475714_967475716 8 Left 967475714 3:189914993-189915015 CCACATTCAGTTTTGCAAGTCTA No data
Right 967475716 3:189915024-189915046 CCTGAATCATCACCCTAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967475716 Original CRISPR CCTGAATCATCACCCTAGAG CGG Intergenic
No off target data available for this crispr